Transposable Element Finder (TEF) - Detection of active transposable elements from NGS data

[Top Page]
TEF is a high-performance detector of active transposable elements from short-reads of next generation sequencer, based on detection of Target Site Duplication (TSD) at the transposition.
Scripts and Readme: https://github.com/akiomiyao/tef/

Detection of transposed TEs in Arabidopsis thaliana herbarium specimen DOI

Transposed TEs have been detected from herbarium specimen of old Arabidopsis thaliana.
The history of TE evolution can be revealed by specimens kept in the herbarium.
The expansion of the territory of Arabidopsis lines can also be grasped.

Genotype table of Junction method for SRR21814507 and SRR21814514

Accession Chromosome Junction of
Head
Junction of
Tail
Direction TE Head TE Tail Flanking of Head TSD Flanking of Tail SRR21814507 SRR21814514 Genotype
HeadTailNo-Ins.HeadTailNo-Ins.
SRR2181450711394162113941619fCAAATAAAGCTCTAATGGTAGATCCCATCTACCCAAAGTACCCATCTACCCAGAGTATAATAATAACAATGAAGTTCTAATGG76270027H
SRR2181450711418020214180200fCAAATAAAGCTCTAATGGTAGATCCCATCTACCCAAAGTACCCATCTACCCAGAGTACATCATCATCAAATGAAGCTCTAATG232320033H
SRR2181450711508984315089840fCCAAAGTCCGTATGAGTCTTATTCTCAAAGCTTTGATAGTTCAAAGCTTTGATGGTGAACGAACGAACCCGAAGTTCTTAACAG27229400117H
SRR2181450711514969515149692fCCAAAGTCCGTATGAGTCTTATTCTCAAAGCTTTGATAGTTCAAAGCTTTTATGGTGTGGGTGGGTGGCCGATGTTCTCATGAG222330029H
SRR2181450711749145917491466rTAGGGGTGTCAAAATGGGTCTACCCATTTTGACACCCCTAATATGTTCCTTAACCATAACACCATAACACCATAACTAATATTCAATA4100004M
SRR2181450711749146617491459fTAGGGGTGTCAAAATGGGTAGACCCATTTTGACACCCCTATATTGAATATTAGTTATGGTGTTATGGTGTTATGGTTAAGGAACATAT104190016H
SRR2181450712569822325698221fTTTTCCCGCCAAAACCATAACCCGCCAAAACCGTAAAATCCAGCAAACTGCAAAATCATAATAATATTTTCCCGCCAAAACCG1240005M
SRR2181450712759782827597821fTAGGCCTGGGCAAAATACCCTACCCAAACGCCCAGGACTATGATATTTGATATCTAGAGTTCTAGAGTTCTAGAGTCTAGACCTTGAT1580002M
SRR21814507254665470rTGTAACGACCGCGTCCCGCGGTCCGGGACGGGGTCTCACAGAAACCTTGTTACGACTTCTCTTCTCTTCTCCTTCCTCTAAATGA18173510002497H
SRR21814507254705466fTGTGAGACCCCGTCCCGGACCGCGGGACGCGGTCGTTACATCATTTAGAGGAAGGAGAAGAGAAGAGAAGTCGTAACAAGGTTTC17183336002301H
SRR21814507234673603467364rTGATAATAGGTTTTTCAGTCTGCAAAATACACACTTATCACTGACTATGCATAGGACTACACTACACTACTAAGGTGAAAAGACA49470022H
SRR21814507234673633467360fTTGATAAGTGTGTATTTTGCGACTGAAAAACCTATTATCACTGTCTTTTCACCTTAGTAGGTAGGTAGTCCTATGCATAGTCAG94460022H
SRR21814507236625433662538fGCAGTTTAAGTTCTTATACTACAACTTAGGCTTTTAAGATTAGGCTTTTAAGATCTGATTCTGATTCTGATTGCGGTTCTAGTTCT21212009H
SRR21814507287254648725471rTAGGGGTGTCAAAATGGGTAGACCCATTTTGACACCCCTACATGTGTTTAATGATTTATAGATTTATAGATTTATATGATCCTGATAT520006M
SRR2181450721065806910658073rTGTTAGAGTAAAATTCTTTTATCAAGTTTAACTTTCAACATATATTTTCGGAGATGGGTGGGGTGGGGTGCTGGTAAAAAGCTTG5210004H
SRR2181450721065807310658069fTGTTGAAAGTTAAACTTGATAAAAGAATTTTACTCTAACACAAGCTTTTTACCAGCACCCCACCCCACCCATCTCCGAAAATATA258006H
SRR218145073188166188173rCAGTGTTTTCACGCCCGACCGGTCGGGTTTCAAAACATTGTGTTTGTATTATCTGTTAGTCTGTTAGTCTGTTAGTTATAGAATCATA61000014M
SRR218145073188173188166fCAATGTTTTGAAACCCGACCGGTCGGGCGTGAAAACACTGTATGATTCTATAACTAACAGACTAACAGACTAACAGATAATACAAACA10600011M
SRR21814507342667314266735rTGTTATGAATAAAGATGGATCTCTTTCTCTGTTTATAACAATCCACTATAATTTGATTAAATTAAATTAAAGATTTTTTGTTTTT496008H
SRR21814507342667354266731fTGTTATAAACAGAGAAAGAGATCCATCTTTATTCATAACAAAAAACAAAAAATCTTTAATTTAATTTAATCAAATTATAGTGGAT944006H
SRR2181450731909984419099848rTGTTAGAGTAAAATTCTTTTATCAAGTTTAACTTTCAACACAACTTACTATCAATCTCATCTCATCTCATATGATTACTTCCACA850004M
SRR2181450731909984819099844fTGTTGAAAGTTAAACTTGATAAAAGAATTTTACTCTAACATGTGGAAGTAATCATATGAGATGAGATGAGATTGATAGTAAGTTG580004M
SRR21814507426038362603840rTGTTGAAAGTTAAACTTGATAAAAGAATTTTACTCTAACAATCAAGAGCAATGAGTTGCTTTGCTTTGCTCAATATAACATTTTA420006M
SRR21814507426038402603836fTGTTAGAGTAAAATTCTTTTATCAAGTTTAACTTTCAACATAAAATGTTATATTGAGCAAAGCAAAGCAACTCATTGCTCTTGAT240004M
SRR21814507426304852630487rCACTACAAGAAATATCTACATGTAGATATTTCTTGTAGTGCAAGATTTGACCCGTTTTATTATTATCTTGGGTCGACCAGGTC840009M
SRR21814507426304872630485fCACTACAAGAAATATCTACATGTAGATATTTCTTGTAGTGGACCTGGTCGACCCAAGATAATAATAAAACGGGTCAAATCTTG480009M
SRR21814507439661693966175rCCGATCTTGTAAGCCTAAGTATTAAGTATAAGAACTTAAAATAAGAACTTAAACAACAATCAACAATCAACAATCTTATCCTAAAAG4200041M
SRR21814507465458176545810fTAGGCCTGGGCAAAATACCCTACCCAAACGCCCAGGACTATAAGCTAGATCTGTTTTGTAGTTTTGTAGTTTTGTATAAGAAATATTA41600010M
SRR21814507484180818418085rTGTTATAAACAGAGAAAGAGATCCATCTTTATTCATAACAAAAAGAAAAAAACTGAATTCAATTCAATTCAAACTTTTTATTCCT640004M
SRR21814507484180858418081fTGTTATGAATAAAGATGGATCTCTTTCTCTGTTTATAACAAGGAATAAAAAGTTTGAATTGAATTGAATTCAGTTTTTTTCTTTT460004M
SRR2181450741161322511613232rTAGGCCTGGGAGTTCGGTTTTAGCCGAAATCCCAGGCCTAGAGCTGGCAACTATTAAGGCATTAAGGCATTAAGGCTATAATAATCGA838001H
SRR2181450741161323211613225fTAGGCCTGGGATTTCGGCTAAAACCGAACTCCCAGGCCTATCGATTATTATAGCCTTAATGCCTTAATGCCTTAATAGTTGCCAGCTC386001H
SRR21814507518713791871386rCAGTGTTTTCACGCCCGACCGGTCGGGTTTCAAAACATTGAACAGATTGTATAAAAATATAAAAATATAAAAATATCAATTAACCAAT21300013M
SRR21814507518713861871379fCAATGTTTTGAAACCCGACCGGTCGGGCGTGAAAACACTGATTGGTTAATTGATATTTTTATATTTTTATATTTTTATACAATCTGTT13200015M
SRR2181450751080554310805547rTGTAACGACCGCGTCCCGCGGTCCGGGACGGGGTCTCACATTCAGAATTTTGTTGATATTATATTATATTGATGTAGATTTCAGT4530011H
SRR2181450751080554710805543fTGTGAGACCCCGTCCCGGACCGCGGGACGCGGTCGTTACAACTGAAATCTACATCAATATAATATAATATCAACAAAATTCTGAA5420011H
SRR2181450751503411015034114rTATAGATGTTTATAGAAGAGTATCAATCATATCCTCAATAAAAAAATGGTACGGTGTAAAGTAAAGTAAATATGATAACATTTTA2700014M
SRR2181450751503411415034110fTATTGAGGATATGATTGATACTCTTCTATAAACATCTATATAAAATGTTATCATATTTACTTTACTTTACACCGTACCATTTTTT7210014H
SRR2181450752195765621957665rGGGAAAAATGTTGTTTTATATATAAAACAACATTTTTCCCAAAGCAAGCAATTGAATAACATTGAATAACATTGAATAACAATCACTTTC11500011M
SRR2181450752195766521957656fGGGAAAAATGTTGTTTTATATATAAAACAACATTTTTCCCGAAAGTGATTGTTATTCAATGTTATTCAATGTTATTCAATTGCTTGCTTT5110009M
SRR2181450752246679422466798rTATAGATGTTTATAGAAGAGTATCAATCATATCCTCAATATGACACAGAAGGCTTCACTCCACTCCACTCTTGCCAAGGAAGATG3160003M
SRR2181450752246679822466794fTATTGAGGATATGATTGATACTCTTCTATAAACATCTATACATCTTCCTTGGCAAGAGTGGAGTGGAGTGAAGCCTTCTGTGTCA1630003M
SRR2181451411398159713981604rTAGGGGTGTCAAAATGGGTCTACCCATTTTGACACCCCTAAAACTACAATATACTACACAACTACACAACTACACACTAACATTCCTT002621216H
SRR2181451411398160413981597fTAGGGGTGTCAAAATGGGTAGACCCATTTTGACACCCCTAAAGGAATGTTAGTGTGTAGTTGTGTAGTTGTGTAGTATATTGTAGTTT004612213H
SRR2181451412540095125400953rTTTTCCCGCCAAAACCATAACCCGCCAAAACCGTAAAATCGCCAAAATCGTAAAATCACGACGACGTTTTCTCGCCAAAAACG0016252H
SRR21814514233853381fTGTAACGCCCGCGATCCTCAGTCCGGATCGGGGCCTTTCAATGAGTTCCGGGGCCTGTGTTGTGTTGTGTTTCGTACCTAATTTG003853222518H
SRR21814514256235627rTGTGAGACCCCGTCCCGGACCGCGGGACGCGGTCGTTACAGATAAAAGCTCCCGAGCATGGCATGGCATGCCGATACGCGAAACC0020722592H
SRR21814514256275623fTGTAACGACCGCGTCCCGCGGTCCGGGACGGGGTCTCACAGGTTTCGCGTATCGGCATGCCATGCCATGCTCGGGAGCTTTTATC0020922596H
SRR21814514266266630rTGTAACGCCCGCGATCCTCAGTCCGGATCGGGGCCTTTCAGTAATCCGCGTCGGTCCACGCCACGCCACGCCCCGAATCGATCGG00208364921H
SRR21814514266306626fTGAAAGGCCCCGATCCGGACTGAGGATCGCGGGCGTTACACCGATCGATTCGGGGCGTGGCGTGGCGTGGACCGACGCGGATTAC00203746900H
SRR21814514269997003rTGTAACGCCCGCGATCCTCAGTCCGGATCGGGGCCTTTCATCAGTATCGCTGCGGGCTTCGCTTCGCTTCCACCAGAGTTTCCTC003559241926H
SRR21814514270036999fTGAAAGGCCCCGATCCGGACTGAGGATCGCGGGCGTTACAGAGGAAACTCTGGTGGAAGCGAAGCGAAGCCCGCAGCGATACTGA003406421829H
SRR21814514271707174rTGAAAGGCCCCGATCCGGACTGAGGATCGCGGGCGTTACAGAGAATAGGTCGAGGGCGTTGCGTTGCGTTGCGCCCCCAATGCCT003221521449H
SRR21814514274987502rTGAAAGGCCCCGATCCGGACTGAGGATCGCGGGCGTTACACTCCTACTCATCGAGGCCTGGCCTGGCCTGGCTCTTGCCCCGACG002562321096H
SRR21814514275027498fTGTAACGCCCGCGATCCTCAGTCCGGATCGGGGCCTTTCACGTCGGGGCAAGAGCCAGGCCAGGCCAGGCCTCGATGAGTAGGAG002481231064H
SRR21814514290139017rTGTAACGCCCGCGATCCTCAGTCCGGATCGGGGCCTTTCACTTCACAATGATAGGAAGAGAAGAGAAGAGCCGACATCGAAGGAT004520282921H
SRR2181451422145121455rTGAAAGGCCCCGATCCGGACTGAGGATCGCGGGCGTTACACTGGAAGGCCATAGGTGCATTGCATTGCATGTGGCCGGTGTGGAA0010465164H
SRR2181451422145521451fTGTAACGCCCGCGATCCTCAGTCCGGATCGGGGCCTTTCATTCCACACCGGCCACATGCAATGCAATGCACCTATGGCCTTCCAG009556161H
SRR21814514219062631906267rTGTAACGCCCGCGATCCTCAGTCCGGATCGGGGCCTTTCATTTCTCCGTACGGGTCTAATCTAATCTAATACTAGTAGTCAATGA0011420M
SRR21814514219062671906263fTGAAAGGCCCCGATCCGGACTGAGGATCGCGGGCGTTACATCATTGACTACTAGTATTAGATTAGATTAGACCCGTACGGAGAAA0013240M
SRR21814514236243963624401rGCAGTTTAAGTTCTTATACTACAACTTAGGCTTTTAAGATTAGGCTTTTAAGATCGGGATCGGGATCGGGATGCGGTTTAAGTTCT00422122H
SRR21814514239705073970515rTACTCGATCTCTAGGCCATCGATGGCCTAGAGATCGAGTATTGGTCGAGTATGAGTGATGTGAGTGATGTGAGTGATGTTTAAAAACCT006230M
SRR21814514239705153970507fTACTCGATCTCTAGGCCATCGATGGCCTAGAGATCGAGTAAGGTTTTTAAACATCACTCACATCACTCACATCACTCATACTCGACCAA0022324H
SRR21814514242237604223764rTGATACAGGATTAACGTGTGTCGCAGGTTTCCCTGTAACAATGGACGTAAAATCGGTCACGTCACGTCACAAAGGTGGCTGATCT00572333H
SRR21814514242237644223760fTGTTACAGGGAAACCTGCGACACACGTTAATCCTGTATCAAGATCAGCCACCTTTGTGACGTGACGTGACCGATTTTACGTCCAT00533230H
SRR2181451421362189513621901rGGATTTTTAGTAATTAAACCTTTTATTACTAAAAACCCTAGTTTACGATTTTAAAGTAAAAAGTAAAAAGTAAATAATATAAACTCA00617100M
SRR2181451421362190113621896fTAGGGTTTTTAGTAATAAAAGTTTAATTACTAAAAATCCTTGAGTTTATATTATTTACTTTTACTTTTACTTTAAAATCGTAAACG00710170M
SRR21814514347758124775821rGGAGAAACGGTCTATTTCCCGGGAAATAGACCGTTTCTCCCTATACTTGTATGTAATCAAATGTAATCAAATGTAATCAACTCTGTACCT0012840M
SRR21814514347758214775812fGGAGAAACGGTCTATTTCCCGGGAAATAGACCGTTTCTCCAGGTACAGAGTTGATTACATTTGATTACATTTGATTACATACAAGTATAG0014480M
SRR21814514351193765119383rTAGGCCTGGGATTTCGGCTAAAACCGAACTCCCAGGCCTAGCTGTCTCTATATTCAAAACTTCAAAACTTCAAAACCTCTGTTTGTTT008740M
SRR21814514351193835119376fTAGGCCTGGGAGTTCGGTTTTAGCCGAAATCCCAGGCCTAAAACAAACAGAGGTTTTGAAGTTTTGAAGTTTTGAATATAGAGACAGC008470M
SRR21814514360097036009707rTGTTGGTGTTTGAAAAAGTCTTTTAGTCAAACAATTCACAACAATAATAAACCGTTGCACTGCACTGCACTCAGTGATGTCAGAT0082140M
SRR21814514360097076009703fTGTGAATTGTTTGACTAAAAGACTTTTTCAAACACCAACAATCTGACATCACTGAGTGCAGTGCAGTGCAACGGTTTATTATTGT0061420M
SRR2181451431149911611499120rTGATAATAGGTTTTTCAGTCTGCAAAATACACACTTATCATCTTCATCCGCTATGAGTTTAGTTTAGTTTCTTAAGTTGTATAAA0056132H
SRR2181451431149911911499116fTTGATAAGTGTGTATTTTGCGACTGAAAAACCTATTATCATTTTATACAACTTAAGAAACAAACAAACTCATAGCGGATGAAGA0051362H
SRR2181451431671877516718779rTGATACAGGATTAACGTGTGTCGCAGGTTTCCCTGTAACAATATATGCTGAGATATAAACTAAACTAAACGTTTACCTCAAGCGA007360M
SRR2181451431671877916718775fTGTTACAGGGAAACCTGCGACACACGTTAATCCTGTATCATCGCTTGAGGTAAACGTTTAGTTTAGTTTATATCTCAGCATATAT005630M
SRR2181451432157718821577192rTGTTAGAGTAAAATTCTTTTATCAAGTTTAACTTTCAACATTTAAGACTAGTGTCAATGTAATGTAATGTTTCGTAGCAAGTTTA0065100M
SRR2181451432157719221577188fTGTTGAAAGTTAAACTTGATAAAAGAATTTTACTCTAACATAAACTTGCTACGAAACATTACATTACATTGACACTAGTCTTAAA0041050M
SRR21814514415119451511949rTATAGATGTTTATAGAAGAGTATCAATCATATCCTCAATATCTTTTTTTTCTGTGGAGAGGAGAGGAGAGAGCCTATTTTACGGT004390M
SRR21814514415119491511945fTATTGAGGATATGATTGATACTCTTCTATAAACATCTATAACCGTAAAATAGGCTCTCTCCTCTCCTCTCCACAGAAAAAAAAGA004930M
SRR2181451441122798511227990rTAGGGTTTTTAGTAATAAAAGTTTAATTACTAAAAATCCTGTAGGTTATGTAATAACCACAACCACAACCACTACGGAAAAAGACA007280M
SRR2181451441122799111227985fGGATTTTTAGTAATTAAACCTTTTATTACTAAAAACCCTAGTCTTTTTCCGTAGTGGTTAGTGGTTAGTGGTTATTACATAACCTAC004820M
SRR2181451441181500411815008rTGTTGAAAGTTAAACTTGATAAAAGAATTTTACTCTAACAGCAACTACGCTCGTAAAGTGAAGTGAAGTGTCGCGTCCTCTCAAA0013480M
SRR2181451441181500811815004fTGTTAGAGTAAAATTCTTTTATCAAGTTTAACTTTCAACATTTGAGAGGACGCGACACTTCACTTCACTTTACGAGCGTAGTTGC0011840M
SRR21814514514507251450732rCAATGTTTTGAAACCCGACCGGTCGGGCGTGAAAACACTGCTTGTTTAAAAAGTTTTAACGTTTTAACGTTTTAACAGTTAGGGGTGT0085150M
SRR21814514514507321450725fCAGTGTTTTCACGCCCGACCGGTCGGGTTTCAAAACATTGACACCCCTAACTGTTAAAACGTTAAAACGTTAAAACTTTTTAAACAAG0081550M
SRR2181451451173302311733017fCCGATCTTGTAAGCCTAAGTATTAAGTATAAGAACTTAAACTAAGAACTTAAATCGCAACTCGCAACTCGCAACCCGATCTTATAAG00119221H
SRR2181451451986393219863936rTGTGAATTGTTTGACTAAAAGACTTTTTCAAACACCAACATTGTAGGTTAGGTTGGCTACGCTACGCTACAAGTACAAGACATGA0081360M
SRR2181451451986393619863932fTGTTGGTGTTTGAAAAAGTCTTTTAGTCAAACAATTCACATCATGTCTTGTACTTGTAGCGTAGCGTAGCCAACCTAACCTACAA00106130M

Accession list of co-existence TEs

Transpositions between each accession and SRR13608004(Col-0) were detected by tef(v1.4).
ChrPositionTE Head-TailAccession
1325355GGGTGAATTGCAAAAGTAAC-GTTATACACCCAAATTTCCCSRR21814496SRR21814512
1325363GGGAAATTTGGGTGTATAAC-GTTACTTTTGCAATTCACCCSRR21814496SRR21814512
12233205TGTTATAAACAGAGAAAGAG-ATCCATCTTTATTCATAACASRR21814486SRR21814506SRR21814512SRR21814520
12233209TGTTATGAATAAAGATGGAT-CTCTTTCTCTGTTTATAACASRR21814486SRR21814506SRR21814512SRR21814520
13229241TATTAGTCAAGTAACACACA-TTTTCCGCATATTCTAACAGSRR21814499SRR21814510SRR21814511
13229245TGTTAGAATATGCGGAAAAG-TGTGTGTTACTTGACTAATASRR21814499SRR21814510SRR21814511
16455919ATGGGTTGGGTCAACCCATA-TGGGTTGACCCAACCCATTTSRR21814486SRR21814496SRR21814513
16455926ATGGGTTGGGTCAACCCATA-TGGGTTGACCCAACCCATTTSRR21814486SRR21814496SRR21814513
17537096TAGGGGTGTCAAAATGGGTA-GACCCATTTTGACACCCCTASRR21814487SRR21814501SRR21814506SRR21814516
17537103TAGGGGTGTCAAAATGGGTC-TACCCATTTTGACACCCCTASRR21814506SRR21814516
17537103TAGGGGTGTCAAAATGGGTC-TTACCCATTTTGACACCCCTSRR21814487SRR21814501
18509485TATTAGGGACAATGTCCCAC-TGGAAGCCCACAGTCTAATASRR21814508SRR21814516
18718228TGTAGAATTAGGTATTGAAC-TATACGACCTTATCACAATASRR21814492SRR21814493SRR21814506SRR21814519
18718232TATTGTGATAAGGTCGTATA-GTTCAATACCTAATTCTACASRR21814492SRR21814493SRR21814506SRR21814519
18853957GGGAAAAATGTTGTTTTATA-TATAAAACAACATTTTTCCCSRR21814488SRR21814496SRR21814520
18853966GGGAAAAATGTTGTTTTATA-TATAAAACAACATTTTTCCCSRR21814488SRR21814496SRR21814520
19843924TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACASRR21814496SRR21814502
19843928TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCASRR21814496SRR21814502
19896332GGGAAATTGCAGTGTATAAC-TTACTTTTGCAATTCACCCTSRR21814498SRR21814520
110526748AAAATCACGGGTTTACGTTT-ACGGATTTACGTTTTTGGCGSRR21814503SRR21814514
110527085CTAAACTCATTTAATTATGA-TCAACCCATAACTTATTTAASRR21814486SRR21814497SRR21814508
110527086TTAAATAAGTTATGGGTTGA-TCATAATTAAATGAGTTTAGSRR21814497SRR21814508
110527155TTAAATAAGTTATGGGTTGA-TCATAATTAAATGAGTTTAGSRR21814497SRR21814508
110527156CTAAACTCATTTAATTATGA-TCAACCCATAACTTATTTAASRR21814486SRR21814497SRR21814508
111457813TGTTAGGGGTTAGATTTGGG-GTTTAATTCGTGCATTAACASRR21814492SRR21814515
111457817TGTTAATGCACGAATTAAAC-CCCAAATCTAACCCCTAACASRR21814492SRR21814515
111905704TGTTGAAAGTTAAACTTGAT-AAAAGAATTTTACTCTAACASRR21814497SRR21814508
111905708TGTTAGAGTAAAATTCTTTT-ATCAAGTTTAACTTTCAACASRR21814497SRR21814508
111959292TGAGAGCTCACCTCTTATGC-GGCATAAGTGATAAAAGTTCSRR21814500SRR21814501
111959299GAACTTTTATCACTTATGCC-GGCATAAGAGGTGAGCTCTCSRR21814500SRR21814501
111961875CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGSRR21814489SRR21814509
111961877CACTACAAGAAAACAGGTGA-TTGTCTGTTTTCTTGTAGTGSRR21814489SRR21814509
112714442TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACASRR21814490SRR21814505
112898978TAGGGGTGTCAAAATGGGTA-GACCCATTTTGACACCCCTASRR21814509SRR21814516
112898985TAGGGGTGTCAAAATGGGTC-TACCCATTTTGACACCCCTASRR21814509SRR21814516
112938757TAGGGTGATTTGCAGATATA-GTTAGTTTTGCCAATTCCCCSRR21814501SRR21814515
112938763GGGGAATTGGCAAAACTAAC-TATATCTGCAAATCACCCTASRR21814501SRR21814515
113414457TGATAAGTGTGTATTTTGCA-GACTGAAAAACCTATTATCASRR21814499SRR21814504SRR21814508SRR21814509SRR21814518
113414461TGATAATAGGTTTTTCAGTC-TGCAAAATACACACTTATCASRR21814499SRR21814504SRR21814508SRR21814509SRR21814515SRR21814518
113415263TAACGCCCGTGAACCGGAAA-AAAATGGGTCGGGTTGTTTCSRR21814490SRR21814504
113518227GAGTTACCAACCTTAACAGA-GACCACAAAATCAGCAGGGASRR21814489SRR21814496
113644612AGTTGTCAATCCAAATGGGT-AATCATATCGTTGTAGTACTSRR21814489SRR21814507
113776044TGATAAGTGTGTATTTTGCA-GACTGAAAAACCTATTATCASRR21814492SRR21814493
113920735AAAAACCTATTATCAATTTG-ATGATAGTGCTTTAGGATAASRR21814504SRR21814511
114217842TCAAATTTTTATGGTTTTTT-TTTTGTGAAATAATTTTCTGSRR21814487SRR21814491SRR21814518
114218879TGATAGTAGGATTTTTGTCA-TGCAAATTATAGACATATCASRR21814486SRR21814501SRR21814518
114218883TGATATGTCTATAATTTGCA-TGACAAAAATCCTACTATCASRR21814486SRR21814501
114363799TTAGAAGATACAAAGACAAA-AAACCTAAGTAGTGTTTCCTSRR21814512SRR21814518
114484172GATTGCGGTTTAAGTTCTTA-ACTACTTAGGCGTTTAAGATSRR21814488SRR21814497
114602912TGTCACAATCCAATGCATTT-TCTGTGTTTCTATGGTCAAASRR21814506SRR21814512SRR21814516
114609774CTCTTATAATTAGTCAAAAG-CCTAAACACTCCTAATCCATSRR21814492SRR21814494
114670479ATCTCTAACTCATATAATTA-GTTATCTAAACACTCCTAATSRR21814507SRR21814515
114837110ATCTCTAACTCTTATAATTA-TGTTGTCTAAACACTCCTAASRR21814495SRR21814497
114837112TTAGGAGTGTTTAGACAACA-TAATTATAAGAGTTAGAGATSRR21814494SRR21814495SRR21814497
114932065CTCTTATAATTAGTCAAAAG-CCTAAACACTCCTAATCCATSRR21814492SRR21814494
114933609TTTCTCCCAAAAGAGGCTAA-GTTTAGACAACAATTATACCSRR21814501SRR21814512
114951922GAGTGTTTAGACAACACTTA-TATAAGAGTTAGAAATGGATSRR21814497SRR21814512
114977559TGTCACAATCCAATGCATTT-TCTGTGTTTCTATGGTCAAASRR21814494SRR21814506SRR21814512SRR21814516
115010650TTAGGAGTGTTTAGACAACA-TAATTATAAGAGTTAGAGATSRR21814494SRR21814495SRR21814497
115010652ATCTCTAACTCTTATAATTA-TGTTGTCTAAACACTCCTAASRR21814495SRR21814497
115091412AAACCATAAACCCTAAACCC-CTAAACCCTAAACCCTAAACSRR21814488SRR21814498
115096974CTAAACCCTAACTCTAAACC-CCTAAACCCTAAACCCTAAASRR21814491SRR21814496SRR21814509
115149240CTTTACCATCAAAGCTTTGA-AAAAAACTCATAAGAACTTCSRR21814495SRR21814497
115290944TTTAGGTTTTAAAGTTTGGG-GGATTCCGGAAGCTAAAGTASRR21814490SRR21814504SRR21814513
115291319CTAAACCCTAACTCTAAACC-CCTAAACCCTAAACCCTAAASRR21814491SRR21814496SRR21814509
115493235GCCAAACAACTGGGTGGTCG-TATACTCGACTGCACAGTCTSRR21814512SRR21814518
115517710ATTGCCAATTGGGTGTTTCT-AACCGATTATCAATTTGGCGSRR21814493SRR21814509
115747692TGCTTCTCAAAGCTTTGATG-AAAACACTAACAAAGCTTCTSRR21814493SRR21814499SRR21814516
116051133GCTAGGTTATCTGTAGAATT-CATATGGTTTAGTAGATCGCSRR21814488SRR21814505
116124908AAAATCACGGGTTTACGTTT-ACGGATTTACGTTTTTGGCGSRR21814503SRR21814514
116510353TGAGATTAGGAAGTGGTAAA-CCTGCTTTGCTATGTTTCATSRR21814492SRR21814495
116513871CACTACAAGAAAACAGGTGA-TTGTCTGTTTTCTTGTAGTGSRR21814493SRR21814494
116513873CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGSRR21814493SRR21814495
116664641TAGTCATGTTAATATGGGCT-AACCCATTTTAACATCACTASRR21814492SRR21814493
116664648TAGTGATGTTAAAATGGGTT-TTAGCCCATATTAACATGACSRR21814492SRR21814493
117407923GATCTCTTATTTGAGAGAGT-TGTGGAATTCGACCCTTAAGSRR21814496SRR21814499SRR21814504SRR21814514SRR21814516SRR21814518
117407931ACTTAAGGGTCGAATTCCAC-CACTCTCTCAAATAAGAGATSRR21814488SRR21814491SRR21814496SRR21814498SRR21814499SRR21814504SRR21814516SRR21814518SRR21814519
117407932CTTAAGGGTCGAATTCCACA-ACTCTCTCAAATAAGAGATCSRR21814488SRR21814491SRR21814496SRR21814499SRR21814504SRR21814506SRR21814516SRR21814518SRR21814519
117653176CACTACAACAAATATCAACA-TGAGGACTTTTTTTGTAGTGSRR21814494SRR21814495SRR21814496SRR21814498SRR21814499SRR21814512SRR21814517SRR21814518
117653178CACTACAAAAAAAGTCCTCA-TGTTGATATTTGTTGTAGTGSRR21814494SRR21814495SRR21814496SRR21814498SRR21814499SRR21814512SRR21814517SRR21814518
118222053AAGAAATTTTCACAAAAGTG-TGTGGCCTGCAATTTACCCTSRR21814496SRR21814505
118302180ATTTTTTTCTCAGCCAAAAA-AAATCCCGCCAAAACTTTTTSRR21814492SRR21814493
118886641TGTTATGAATAAAGATGGAT-CTCTTTCTCTGTTTATAACASRR21814491SRR21814506
118895989GGGAAAAAACCCGAAAAAAC-GTTTTTTCGGGTTTTTTCCCSRR21814510SRR21814511SRR21814515
118895998GGGAAAAAACCCGAAAAAAC-GTTTTTTCGGGTTTTTTCCCSRR21814510SRR21814511SRR21814515
119721628TAGGGGTGTCAAAATGGGTA-GACCCATTTTGACACCCCTASRR21814506SRR21814514
119721635TAGGGGTGTCAAAATGGGTC-TACCCATTTTGACACCCCTASRR21814506SRR21814514
120449242GGGAAAAATGTCAAAAAAAG-CTTTTTTTGACATTTTTCCCSRR21814494SRR21814516
120449251GGGAAAAATGTCAAAAAAAG-CTTTTTTTGACATTTTTCCCSRR21814494SRR21814516
120479740GGGTCAATTGCAAGAATATC-GTTATAGATGCAAATTTCCCSRR21814499SRR21814504
120479748GGGAAATTTGCATCTATAAC-GATATTCTTGCAATTGACCCSRR21814499SRR21814504
120942470TAGTGATGTTAAAATGGGTT-TTAGCCCATATTAACATGACSRR21814492SRR21814493SRR21814495SRR21814517
120942477TAGTCATGTTAATATGGGCT-AACCCATTTTAACATCACTASRR21814492SRR21814493SRR21814495SRR21814517
121177613AAGAAATTTTCACAAAAGTG-TGTGGCCTGCAATTTACCCTSRR21814494SRR21814501SRR21814504
121177621GGGTAAATTGCAGGCCACAC-CACTTTTGTGAAAATTTCTTSRR21814494SRR21814501
121761323TGTTAGAGTAAAATTCTTTT-ATCAAGTTTAACTTTCAACASRR21814489SRR21814518
121761327TGTTGAAAGTTAAACTTGAT-AAAAGAATTTTACTCTAACASRR21814489SRR21814518
121908076TGTTGAAGAATAATCAAATC-TTCATAACAAAACATTAACASRR21814496SRR21814499
121908080TGTTAATGTTTTGTTATGAA-GATTTGATTATTCTTCAACASRR21814496SRR21814499
122116990AAGAAATTTTCACAAAAGTG-TGTGGCCTGCAATTTACCCTSRR21814494SRR21814496SRR21814517
122116998GGGTAAATTGCAGGCCACAC-CACTTTTGTGAAAATTTCTTSRR21814494SRR21814496SRR21814517
122305255GGGTATATGCACTAGATGAC-TCATTCAGTAAATTAACCCTSRR21814501SRR21814505SRR21814510SRR21814511
123197636TAACGCCCGTGAACCGGAAA-AAAATGGGTCGGGTTGTTTCSRR21814490SRR21814504
123380121TATTAGGGACAATGTCCCAC-TGGAAGCCCACAGTCTAATASRR21814508SRR21814516
123394967GGGAAATTGCAGTGTATAAC-TTACTTTTGCAATTCACCCTSRR21814498SRR21814520
124295169GTAAGATTTGCTTAGATTGA-GTTACTCTAGTAAATTTCCCSRR21814501SRR21814513
124428675TAAGGGTTAATTTGCAAACT-ACTATTTTGCCAACACACCCSRR21814492SRR21814493
124450470TGTTGAAAGAATTGCATCAT-TTAACCAACTATTCTCTACASRR21814499SRR21814506
124459726CAATGTTTTTAAAACCGACC-GGTCGGGCGTGAAAACACTGSRR21814492SRR21814493
124459727CCAATGTTTTTAAAACCGAC-TCGGGCGTGAAAACACTGCTSRR21814492SRR21814493
124459732GCAGTGTTTTCACGCCCGAC-GTCGGTTTTAAAAACATTGGSRR21814492SRR21814493
124459733CAGTGTTTTCACGCCCGACC-GGTCGGTTTTAAAAACATTGSRR21814492SRR21814493
125723013CAAAATCGCAAAATCATATT-ACCGCAAAATCATATTTTCCSRR21814500SRR21814501
128012294CAATGTTTTTAAAACCGACC-GGTCGGGCGTGAAAACACTGSRR21814492SRR21814493
128012301CAGTGTTTTCACGCCCGACC-GGTCGGTTTTAAAAACATTGSRR21814492SRR21814493
128997027TGTTATGAATAAAGATGGAT-CTCTTTCTCTGTTTATAACASRR21814507SRR21814518
128997031TGTTATAAACAGAGAAAGAG-ATCCATCTTTATTCATAACASRR21814507SRR21814518
129099460GGATTTTTAGTAATTAAACC-GTTTTATTACTAAAAACCCTSRR21814490SRR21814500SRR21814501
129099468GGGTTTTTAGTAATAAAACC-GTTTAATTACTAAAAATCCTSRR21814500SRR21814501
129630582GGGCTGCCTATAGGAGGCCC-GGGCCTCCTATAGGCAGCCCSRR21814498SRR21814502SRR21814505SRR21814506
129630590GGGCTGCCTATAGGAGGCCC-GGGCCTCCTATAGGCAGCCCSRR21814498SRR21814502SRR21814505SRR21814506
129999910GAGAATATTACACGTAGAGG-TAAACGTGTCACATTCCCTASRR21814487SRR21814488
130168816ATAGGGGTGTCAAAATGGGT-ACCCATTTTGACACCCCTATSRR21814509SRR21814517
130168821ATAGGGGTGTCAAAATGGGT-ACCCATTTTGACACCCCTATSRR21814509SRR21814517
29073TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCASRR21814501SRR21814514SRR21814516
29077TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACASRR21814501SRR21814514SRR21814516
2176803GAACTTTTAAATTTGGGACG-GAAAAAATGTCAAAAAAATCSRR21814510SRR21814511
2245347TGTTGAAAGTTAAACTTGAT-AAAAGAATTTTACTCTAACASRR21814488SRR21814500SRR21814501SRR21814513
2245351TGTTAGAGTAAAATTCTTTT-ATCAAGTTTAACTTTCAACASRR21814488SRR21814500SRR21814501SRR21814513
2735485TGTTGAAAGTTAAACTTGAT-AAAAGAATTTTACTCTAACASRR21814498SRR21814513
2735489TGTTAGAGTAAAATTCTTTT-ATCAAGTTTAACTTTCAACASRR21814498SRR21814513
21000758TGTTAATGCACGAATTAAAC-CCCAAATCTAACCCCTAACASRR21814492SRR21814509
21000762TGTTAGGGGTTAGATTTGGG-GTTTAATTCGTGCATTAACASRR21814492SRR21814509
21392350TGTAACGACCGCGTCCCGCG-GTCCGGGACGGGGTCTCACASRR21814516SRR21814518
21400069AAGAAATTTTCACAAAAGTG-TGTGGCCTGCAATTTACCCTSRR21814501SRR21814517
21400077GGGTAAATTGCAGGCCACAC-CACTTTTGTGAAAATTTCTTSRR21814501SRR21814517
21752118TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCASRR21814495SRR21814517
21752122TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACASRR21814495SRR21814517
21906263TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCASRR21814499SRR21814514
21906267TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACASRR21814499SRR21814514
22139704AGGATTTTTAGTAATTAAAC-GTTTTATTACTAAAAACCCTSRR21814504SRR21814513
22139711GGGTTTTTAGTAATAAAACC-GTTTAATTACTAAAAATCCTSRR21814504SRR21814513
22175140TAGGGTGATTTGCAGATATA-GTTAGTTTTGCCAATTCCCCSRR21814501SRR21814515
22175146GGGGAATTGGCAAAACTAAC-TATATCTGCAAATCACCCTASRR21814501SRR21814515
22344412GGGAAATTTGGGTGTATAAC-GTTACTTTTGCAATTCACCCSRR21814512SRR21814516
22344420GGGTGAATTGCAAAAGTAAC-GTTATACACCCAAATTTCCCSRR21814512SRR21814516
22717325TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCASRR21814493SRR21814495
22953379CACTACAAGAAAACAGGTAA-TCACCTGTTTTCTTGTAGTGSRR21814488SRR21814516
22953381CACTACAAGAAAACAGGTGA-TTACCTGTTTTCTTGTAGTGSRR21814488SRR21814516
23044561CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGSRR21814490SRR21814495
23044563CACTACAAGAAAACAGGTGA-TTGTCTGTTTTCTTGTAGTGSRR21814490SRR21814495
23662070TTTTGGAGTCAAATATGACT-AGCAAGAAGAAGCTTGGTTASRR21814493SRR21814501SRR21814507SRR21814508
23662072TAACCAAGCTTCTTCTTGCT-AGTCATATTTGACTCCAAAASRR21814495SRR21814500SRR21814501SRR21814506SRR21814507SRR21814508SRR21814513SRR21814515SRR21814516
23713260TAAAAGCATAAGTAGTGTTT-TATAACAACTTAAACCGCAASRR21814501SRR21814502
23909712TGATAAGTGTGTATTTTGCA-GACTGAAAAACCTATTATCASRR21814492SRR21814493SRR21814495SRR21814509
23909716TGATAATAGGTTTTTCAGTC-TGCAAAATACACACTTATCASRR21814492SRR21814495SRR21814509
24076554TGTTGGTGCAGGAATTAGCA-GTTTGATTACAGAATCAACASRR21814492SRR21814493
24076558TGTTGATTCTGTAATCAAAC-TGCTAATTCCTGCACCAACASRR21814492SRR21814493
24223760TGATACAGGATTAACGTGTG-TCGCAGGTTTCCCTGTAACASRR21814512SRR21814514
24223764TGTTACAGGGAAACCTGCGA-CACACGTTAATCCTGTATCASRR21814512SRR21814514
24225669TGATAATAGGTTTTTCAGTC-TGCAAAATACACACTTATCASRR21814499SRR21814510SRR21814511SRR21814518
24225673TGATAAGTGTGTATTTTGCA-GACTGAAAAACCTATTATCASRR21814499SRR21814510SRR21814518
24402323TGATATGTCTATAATTTGCA-TGACAAAAATCCTACTATCASRR21814486SRR21814501
24402327TGATAGTAGGATTTTTGTCA-TGCAAATTATAGACATATCASRR21814486SRR21814501
24978768TTTCACATTGTAAAAGCTCT-CATACTTTTACACTTGTAATSRR21814494SRR21814495
25302002TGATAATAGGTTTTTAAGTC-TGCAAAATACACACTTATCASRR21814488SRR21814500SRR21814506SRR21814512SRR21814513
25302006TGATAAGTGTGTATTTTGCA-GACTTAAAAACCTATTATCASRR21814488SRR21814500SRR21814506SRR21814512SRR21814513
25398835TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACASRR21814488SRR21814490SRR21814512SRR21814516
25398839TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCASRR21814490SRR21814516
25417285GGGTTGGCTGATTTTATACC-GGTATAAAATCAGCCAACCCSRR21814486SRR21814491SRR21814501SRR21814513SRR21814515
25417293GGGTTGGCTGATTTTATACC-GGTATAAAATCAGCCAACCCSRR21814486SRR21814491SRR21814501SRR21814513SRR21814515
25627731GAACTTTTATCACTTATGCC-GGCATAAGAGGTGAGCTCTCSRR21814492SRR21814493SRR21814495SRR21814512SRR21814513
25627739GAGAGCTCACCTCTTATGCC-GGCATAAGTGATAAAAGTTCSRR21814492SRR21814493SRR21814495SRR21814512SRR21814513
26007110CACTACAAGAAAATTGCCAT-TTAACTGTTTTCTTGTAGTGSRR21814492SRR21814493SRR21814496SRR21814501SRR21814506SRR21814508SRR21814516
26007112CACTACAAGAAAACAGTTAA-ATGGCAATTTTCTTGTAGTGSRR21814492SRR21814493SRR21814496SRR21814501SRR21814506SRR21814508SRR21814516
26715532GGGTTTACGTTTTTGGCGGG-ACGGATTTACGTTTTTGGCGSRR21814505SRR21814518
26897367AAATAAAAGTACAATATATC-CAATATATCATCTCAAAAATSRR21814503SRR21814505
27975617TGTGGATGTCGGAATCCGCA-CCGAATCCGACATCCACAATSRR21814508SRR21814512
27975619ATTGTGGATGTCGGATTCGG-TGCGGATTCCGACATCCACASRR21814508SRR21814512
28099376CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGSRR21814508SRR21814518
29757877TAGGATTTTTAGTAATTAAA-GTTTTATTACTAAAAACCCTSRR21814510SRR21814511
210071472TGTTATGAATAAAGATGGAT-CTCTTTCTCTGTTTATAACASRR21814492SRR21814493SRR21814506
210071476TGTTATAAACAGAGAAAGAG-ATCCATCTTTATTCATAACASRR21814492SRR21814493SRR21814506
210360554GGCCCTGTTCGTTTGCTTGT-ACAGGGAAACGAACAGGGCCSRR21814494SRR21814509SRR21814516
210360556GGCCCTGTTCGTTTCCCTGT-ACAAGCAAACGAACAGGGCCSRR21814494SRR21814509SRR21814516
211267241GAACTTTTAAATTTGGGACG-GAAAAAATGTCAAAAAAATCSRR21814510SRR21814511
211729173GCCTTGAATGGCTGCAGTTT-ACTACAAAACATTCAGGGCCSRR21814502SRR21814505SRR21814506
212374121TGTAGAATAAGGTATTGAAC-GTTCAATACCTTATTCTACASRR21814487SRR21814491SRR21814495SRR21814507
212374125TGTAGAATAAGGTATTGAAC-GTTCAATACCTTATTCTACASRR21814487SRR21814491SRR21814495SRR21814507
212979052GGGAAAAATGTCATAAAAAT-ATTTTTATGACATTTTTCCCSRR21814500SRR21814501
212979061GGGAAAAATGTCATAAAAAT-ATTTTTATGACATTTTTCCCSRR21814500SRR21814501
213127628TGTTATAAACAGAGAAAGAG-ATCCATCTTTATTCATAACASRR21814506SRR21814519
213127632TGTTATGAATAAAGATGGAT-CTCTTTCTCTGTTTATAACASRR21814506SRR21814519
213621895GGATTTTTAGTAATTAAACC-GTTTTATTACTAAAAACCCTSRR21814487SRR21814490SRR21814515SRR21814517
213621896AGGATTTTTAGTAATTAAAC-GTTTTATTACTAAAAACCCTSRR21814504SRR21814513
213621903GGGTTTTTAGTAATAAAACC-GGTTTAATTACTAAAAATCCSRR21814487SRR21814490
213621903GGGTTTTTAGTAATAAAACC-GTTTAATTACTAAAAATCCTSRR21814504SRR21814513SRR21814515
215131024TGTTATGAATATTAGATGGA-CTTCTTCTTCTTTTCTAACASRR21814492SRR21814516SRR21814518
215131028TGTTAGAAAAGAAGAAGAAG-TCCATCTAATATTCATAACASRR21814492SRR21814516SRR21814518
215348090TAAGGGTTAATTTGCAAACT-ACTATTTTGCCAACACACCCSRR21814492SRR21814493
217787420CAATGTTTTTAAACCCGACC-GGTCGGGCATGAAAACACTGSRR21814510SRR21814511
218040044CACTACAAGAAAATTGCCAT-TTAACTGTTTTCTTGTAGTGSRR21814492SRR21814493SRR21814496SRR21814501SRR21814506SRR21814516
218040046CACTACAAGAAAACAGTTAA-ATGGCAATTTTCTTGTAGTGSRR21814492SRR21814493SRR21814496SRR21814501SRR21814506SRR21814516
218360265TGTTAGAGTAAAATTCTTTT-ATCAAGTTTAACTTTCAACASRR21814488SRR21814504SRR21814508SRR21814517
218360269TGTTGAAAGTTAAACTTGAT-AAAAGAATTTTACTCTAACASRR21814488SRR21814504SRR21814508SRR21814517
218752856GAGGGATCATCTCTTGTGTC-GACTGGCCAGACGATTATTCSRR21814489SRR21814496SRR21814506
218752864GAATAATCGTCTGGCCAGTC-GACACAAGAGATGATCCCTCSRR21814489SRR21814496SRR21814506
219230839TGTTGAAAGTTAAACTTGAT-AAAAGAATTTTACTCTAACASRR21814500SRR21814501
219230843TGTTAGAGTAAAATTCTTTT-ATCAAGTTTAACTTTCAACASRR21814500SRR21814501
31575987GGCCCTGTTCGTTTCCCTGT-ACAAGCAAACGAACAGGGCCSRR21814494SRR21814506SRR21814516
31575989GGCCCTGTTCGTTTGCTTGT-ACAGGGAAACGAACAGGGCCSRR21814494SRR21814516
32654601TGTAGAATTAGGTATTGAAC-TATACGACCTTATCACAATASRR21814492SRR21814493
32654605TATTGTGATAAGGTCGTATA-GTTCAATACCTAATTCTACASRR21814492SRR21814493
34266731TGTTATGAATAAAGATGGAT-CTCTTTCTCTGTTTATAACASRR21814486SRR21814490SRR21814507SRR21814515SRR21814516SRR21814520
34266735TGTTATAAACAGAGAAAGAG-ATCCATCTTTATTCATAACASRR21814486SRR21814490SRR21814507SRR21814515SRR21814516SRR21814520
34775812GGAGAAACGGTCTATTTCCC-GGGAAATAGACCGTTTCTCCSRR21814497SRR21814514
34775821GGAGAAACGGTCTATTTCCC-GGGAAATAGACCGTTTCTCCSRR21814497SRR21814514
35621228GGGTAAATTGCAGGCCACAC-CACTTTTGTGAAAATTTCTTSRR21814508SRR21814517
35621236AAGAAATTTTCACAAAAGTG-TGTGGCCTGCAATTTACCCTSRR21814515SRR21814517
35670953GGGTTTTTAGTAATAAAACC-GTTTAATTACTAAAAATCCTSRR21814496SRR21814500SRR21814501
35670961GGATTTTTAGTAATTAAACC-GTTTTATTACTAAAAACCCTSRR21814496SRR21814499SRR21814500SRR21814501
35710839GGGAATGTGACACGTTTAGG-TCTTAGAGTGTAATATTCTCSRR21814490SRR21814495SRR21814507SRR21814511SRR21814513SRR21814514SRR21814516SRR21814518
35710847GAGAATATTACACTCTAAGA-CCTAAACGTGTCACATTCCCSRR21814490SRR21814495SRR21814507SRR21814511SRR21814513SRR21814514SRR21814516SRR21814518
36009703TGTTGGTGTTTGAAAAAGTC-TTTTAGTCAAACAATTCACASRR21814495SRR21814514
36009707TGTGAATTGTTTGACTAAAA-GACTTTTTCAAACACCAACASRR21814495SRR21814514
36183229TGTTATGAATATTAGATGGA-CTTCTTCTTCTTTTCTAACASRR21814492SRR21814493
36183233TGTTAGAAAAGAAGAAGAAG-TCCATCTAATATTCATAACASRR21814492SRR21814493
36356211GGATTTTTAGTAATTAAACC-GTTTTATTACTAAAAACCCTSRR21814487SRR21814490SRR21814517
36356219GGGTTTTTAGTAATAAAACC-GGTTTAATTACTAAAAATCCSRR21814487SRR21814490
36439018GGCCCTGTTCGTTTCCCTGT-ACAAGCAAACGAACAGGGCCSRR21814494SRR21814506
310553007GGGTTTTCTGCAAAATAACC-GGTTATTTTGCAGAAAACCCSRR21814486SRR21814487SRR21814491SRR21814492SRR21814493SRR21814508SRR21814511
310553015GGGTTTTCTGCAAAATAACC-GGTTATTTTGCAGAAAACCCSRR21814486SRR21814487SRR21814491SRR21814492SRR21814493SRR21814508SRR21814511
310854728GGGAATTTAATGAAAAAAAC-GTTTTTTTCATTAAATTCCCSRR21814501SRR21814514SRR21814515
310854736GGGAATTTAATGAAAAAAAC-GTTTTTTTCATTAAATTCCCSRR21814501SRR21814514SRR21814515
311001155CAATGTTTTTAAACCCGACC-GGTCGGGCATGAAAACACTGSRR21814504SRR21814507
311208023TGTTAGAAAAGAAGAAGAAG-TCCATCTAATATTCATAACASRR21814492SRR21814493
311208027TGTTATGAATAAAGATGGAT-CTCTTTCTCTGTTTATAACASRR21814490SRR21814491
311208027TGTTATGAATATTAGATGGA-CTTCTTCTTCTTTTCTAACASRR21814492SRR21814493
311240532TAGGATTTTTAGTAATTAAA-GTTTTATTACTAAAAACCCTSRR21814510SRR21814511
311900348GTCGAGTATGGTGCTGGATG-TGGCTCCAAAGTCACTCGACSRR21814488SRR21814496SRR21814497SRR21814504SRR21814518
311900353GTCGAGTGACTTTGGAGCCA-CATCCAGCACCATACTCGACSRR21814496SRR21814518
312150305GAGAGCTCACCTCTTATGCC-GGCATAAGTGATAAAAGTTCSRR21814493SRR21814495SRR21814505SRR21814506SRR21814510SRR21814513
312150306TGAGAGCTCACCTCTTATGC-GGCATAAGTGATAAAAGTTCSRR21814498SRR21814500SRR21814501SRR21814502
312150312GGAACTTTTATCACTTATGC-GGCATAAGAGGTGAGCTCTCSRR21814505SRR21814506
312150313GAACTTTTATCACTTATGCC-GGCATAAGAGGTGAGCTCTCSRR21814493SRR21814495SRR21814498SRR21814500SRR21814501SRR21814502SRR21814510SRR21814513
312165774GGAAAAACGGTCATTTCATA-TATGAAATGACCGTTTTTCCSRR21814491SRR21814514SRR21814517
312165783GGAAAAACGGTCATTTCATA-TATGAAATGACCGTTTTTCCSRR21814491SRR21814514SRR21814517
312976404TAGTGATGTTAAAATGGGTT-TTAGCCCATATTAACATGACSRR21814495SRR21814517
312976411TAGTCATGTTAATATGGGCT-AACCCATTTTAACATCACTASRR21814495SRR21814517
313983807GTAAGATTTGCTTAGATTGA-GTTACTCTAGTAAATTTCCCSRR21814487SRR21814508
314201705TTAAAATTCCGGAACCGGGA-AGCGCGAACTTCGAAAGGGGSRR21814506SRR21814515
314872541CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGSRR21814494SRR21814495
314872543CACTACAAGAAAACAGGTGA-TTGTCTGTTTTCTTGTAGTGSRR21814494SRR21814495
314963018TAGGGGTGTCAAAATGGGTA-GACCCATTTTGACACCCCTASRR21814501SRR21814509
315505054GGGTTGGCTGATTTTCGAGC-GCTCGAAAATCAGCCAACCCSRR21814501SRR21814505SRR21814506
315505062GGGTTGGCTGATTTTCGAGC-GCTCGAAAATCAGCCAACCCSRR21814501SRR21814505SRR21814506
315679033CACTACAAGAAAATTGCCAT-TTAACTGTTTTCTTGTAGTGSRR21814506SRR21814508
315679035CACTACAAGAAAACAGTTAA-ATGGCAATTTTCTTGTAGTGSRR21814506SRR21814508
316888192TATTGATTCAAACTATATAT-GCTTCAAGCTTACTCCAACASRR21814510SRR21814511
316888196TGTTGGAGTAAGCTTGAAGC-TATATAGTTTGAATCAATATSRR21814510SRR21814511
316900669CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGSRR21814493SRR21814494
316900671CACTACAAGAAAACAGGTGA-TTGTCTGTTTTCTTGTAGTGSRR21814493SRR21814494
316991928TGTTAGAGTAAAATTCTTTT-ATCAAGTTTAACTTTCAACASRR21814486SRR21814503SRR21814510SRR21814511
316991928TGTTAGAGTAAAATTCTTTT-TCAAGTTTAACTTTCAACACSRR21814492SRR21814493SRR21814494SRR21814495
316991932TGTTGAAAGTTAAACTTGAT-TAAAAGAATTTTACTCTAACSRR21814492SRR21814493SRR21814495SRR21814503
316991932TGTTGAAAGTTAAACTTGAT-AAAAGAATTTTACTCTAACASRR21814486SRR21814494SRR21814511
318422196TGTTAAGAAACAAACTCCAA-AAACCCTATTGAGCTTATCASRR21814504SRR21814505
318422200TGATAAGCTCAATAGGGTTT-TTGGAGTTTGTTTCTTAACASRR21814504SRR21814505
319099844TGTTAGAGTAAAATTCTTTT-ATCAAGTTTAACTTTCAACASRR21814489SRR21814496SRR21814507SRR21814516
319099848TGTTGAAAGTTAAACTTGAT-AAAAGAATTTTACTCTAACASRR21814489SRR21814494SRR21814496SRR21814507SRR21814516
320110791GGGAAAAATGTCGTTAAATC-GATTTAACGACATTTTTCCCSRR21814490SRR21814497SRR21814500SRR21814501
320110800GGGAAAAATGTCGTTAAATC-GATTTAACGACATTTTTCCCSRR21814490SRR21814497SRR21814500SRR21814501
320560690CCAATGTTTTGAAACCCGAC-GTCGGGTTTCAAAACATTGGSRR21814509SRR21814517
320560696CCAATGTTTTGAAACCCGAC-GTCGGGTTTCAAAACATTGGSRR21814509SRR21814517
321577188TGTTAGAGTAAAATTCTTTT-ATCAAGTTTAACTTTCAACASRR21814513SRR21814514
321577192TGTTGAAAGTTAAACTTGAT-AAAAGAATTTTACTCTAACASRR21814513SRR21814514
321833275CAATGTTTTTAAAACCGACC-GGTCGGGCGTGAAAACACTGSRR21814486SRR21814495
322028072GAACTTTTATCACTTATGCC-GGCATAAGAGGTGAGCTCTCSRR21814495SRR21814502
322230579AAGAAATTTTCACAAAAGTG-TGTGGCCTGCAATTTACCCTSRR21814494SRR21814501
322230587GGGTAAATTGCAGGCCACAC-CACTTTTGTGAAAATTTCTTSRR21814494SRR21814501
4530586TGTTGAAAGTTAAACTTGAT-AAAAGAATTTTACTCTAACASRR21814494SRR21814500SRR21814501
4648393TGTTGAAAGAATTGCATCAT-TTAACCAACTATTCTCTACASRR21814487SRR21814501
4648393TGTTGAAAGAATTGCATCAT-TTTAACCAACTATTCTCTACSRR21814486SRR21814495
4648397TGTAGAGAATAGTTGGTTAA-ATGATGCAATTCTTTCAACASRR21814486SRR21814487SRR21814495SRR21814501
4819478TGTTATAAACAGAGAAAGAG-ATCCATCTTTATTCATAACASRR21814503SRR21814509
41511259TAGTGATGTTAATATGGGCT-TGCCCAAGTTAACATCACTASRR21814497SRR21814516
41533309GGGAATTTAATGAAAAAAAC-TTTTTTTCATTAAATTCCCTSRR21814497SRR21814516
41533317GGGAATTTAATGAAAAAAAC-TTTTTTTCATTAAATTCCCTSRR21814497SRR21814516
41763903AAAAACCTATTATCAATTTG-ATGATAGTGCTTTAGGATAASRR21814504SRR21814511
42029642GGGTTGGCTGATTTTATAGC-GCTATAAAATCAGCCAACCCSRR21814512SRR21814516
42029650GGGTTGGCTGATTTTATAGC-GCTATAAAATCAGCCAACCCSRR21814512SRR21814516
42603836TGTTGAAAGTTAAACTTGAT-AAAAGAATTTTACTCTAACASRR21814497SRR21814502SRR21814504SRR21814505SRR21814507
42603840TGTTAGAGTAAAATTCTTTT-ATCAAGTTTAACTTTCAACASRR21814497SRR21814502SRR21814504SRR21814505SRR21814507SRR21814509
42630485CACTACAAGAAATATCTACA-TGTAGATATTTCTTGTAGTGSRR21814497SRR21814504SRR21814507
42630487CACTACAAGAAATATCTACA-TGTAGATATTTCTTGTAGTGSRR21814497SRR21814504SRR21814507
42717106TGAAAGAATATGCGGAATTG-TATTTGAGTCTTGATCAATASRR21814491SRR21814495
42717110TATTGATCAAGACTCAAATA-CAATTCCGCATATTCTTTCASRR21814491SRR21814495
42818578TATTGATCAAGACTCAAATA-CAATTCCGCATATTCTTTCASRR21814491SRR21814495
42818582TGAAAGAATATGCGGAATTG-TATTTGAGTCTTGATCAATASRR21814491SRR21814495
43035912TTTGACTCCAAAACACTAAC-TCAATCGTACACATGACATCSRR21814493SRR21814507SRR21814516
43042645GCTACACCATCAAAGCTTTG-CCAAAGACTCATACGGAGTTSRR21814506SRR21814509
43133471GGGTTTACGTTTTTGGCGGG-ACGGATTTACGTTTTTGGCGSRR21814505SRR21814518
43313998TTCAACGTTTATGTTCTCTG-TTGTTGTTATCATGTTTTCASRR21814488SRR21814489
43977497GATCTTATAAGCCTAAGTAG-ATATAAGAACTTAAACCGCASRR21814486SRR21814490
44015664TTTAGACAACACTTATACCC-TAAGAGTTAGAGATGGATTASRR21814489SRR21814497SRR21814511SRR21814516
44056284TTTAGACAACACTTATACCC-TAAGAGTTAGAGATGGATTASRR21814496SRR21814497SRR21814501SRR21814516SRR21814518
45125758CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGSRR21814487SRR21814508
45395073TAGTCCTGGGCGTTTGGGTA-GGGTATTTTGCCCAGGCCTASRR21814502SRR21814504
45395080TAGGCCTGGGCAAAATACCC-TACCCAAACGCCCAGGACTASRR21814502SRR21814504
45425784TGTTAGAATATGCGGAAAAG-TGTGTGTTACTTGACTAATASRR21814499SRR21814510SRR21814511
45425788TATTAGTCAAGTAACACACA-TTTTCCGCATATTCTAACAGSRR21814499SRR21814510SRR21814511
45560930TGATAGGTTACGGGTGACGT-GATAGGGTCAGACCTTATCASRR21814499SRR21814517
45560934TGATAAGGTCTGACCCTATC-ACGTCACCCGTAACCTATCASRR21814499SRR21814517
45773828TGATACAGGATTAACGTGTG-TCGCAGGTTTCCCTGTAACASRR21814512SRR21814514
45773832TGTTACAGGGAAACCTGCGA-CACACGTTAATCCTGTATCASRR21814512SRR21814514
46180957CACTACAAGAAATTTGTTCA-TGAACAAATTTCTTGTAGTGSRR21814488SRR21814489SRR21814494SRR21814495SRR21814503SRR21814505SRR21814509SRR21814511SRR21814514SRR21814515SRR21814518
46180959CACTACAAGAAATTTGTTCA-TGAACAAATTTCTTGTAGTGSRR21814488SRR21814489SRR21814494SRR21814495SRR21814503SRR21814505SRR21814509SRR21814511SRR21814514SRR21814515SRR21814518
46430150TGTTGAAAGAATTGCATCAT-TTTAACCAACTATTCTCTACSRR21814486SRR21814495SRR21814518
46430154TGTAGAGAATAGTTGGTTAA-ATGATGCAATTCTTTCAACASRR21814486SRR21814495SRR21814500SRR21814518
46899508CACTACAAGAAAACAGGTGA-TTGTCTGTTTTCTTGTAGTGSRR21814489SRR21814509
46899510CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGSRR21814489SRR21814509
46910469TGTTATAAACAGAGAAAGAG-ATCCATCTTTATTCATAACASRR21814512SRR21814520
46910473TGTTATGAATAAAGATGGAT-CTCTTTCTCTGTTTATAACASRR21814512SRR21814520
47102263CAAAATCGCAAAATCATATT-ACCGCAAAATCATATTTTCCSRR21814500SRR21814501
47277746TGTTGAAAGTTAAACTTGAT-AAAAGAATTTTACTCTAACASRR21814500SRR21814501
47277750TGTTAGAGTAAAATTCTTTT-ATCAAGTTTAACTTTCAACASRR21814500SRR21814501
48418081TGTTATAAACAGAGAAAGAG-ATCCATCTTTATTCATAACASRR21814507SRR21814515
48418085TGTTATGAATAAAGATGGAT-CTCTTTCTCTGTTTATAACASRR21814507SRR21814515
48959149TTAGGGAATTTAATGAAAAA-TTTTTTTCATTAAATTCCCASRR21814510SRR21814511
410181388TGTTATAAACAGAGAAAGAG-ATCCATCTTTATTCATAACASRR21814492SRR21814493
410181392TGTTATGAATAAAGATGGAT-CTCTTTCTCTGTTTATAACASRR21814492SRR21814493
411000864TGTTAATGTTTTGTTATGAA-GATTTGATTATTCTTCAACASRR21814489SRR21814496SRR21814499
411000868TGTTGAAGAATAATCAAATC-TTCATAACAAAACATTAACASRR21814489SRR21814496SRR21814499
411035851GGAACTTTTATCACTTATGC-GGCATAAGAGGTGAGCTCTCSRR21814505SRR21814506
411035858GAGAGCTCACCTCTTATGCC-GGCATAAGTGATAAAAGTTCSRR21814505SRR21814506
411475729CAGTGTTTTCACGCCCGACC-GGTCGGTTTTAAAAACATTGSRR21814492SRR21814493
411475730GCAGTGTTTTCACGCCCGAC-GTCGGTTTTAAAAACATTGGSRR21814492SRR21814493
411475735CCAATGTTTTTAAAACCGAC-TCGGGCGTGAAAACACTGCTSRR21814492SRR21814493
411475736CAATGTTTTTAAAACCGACC-GGTCGGGCGTGAAAACACTGSRR21814492SRR21814493
411547176TGTTATGAATAAAGATGGAT-CTCTTTCTCTGTTTATAACASRR21814499SRR21814509
411547180TGTTATAAACAGAGAAAGAG-ATCCATCTTTATTCATAACASRR21814499SRR21814509
411815004TGTTGAAAGTTAAACTTGAT-AAAAGAATTTTACTCTAACASRR21814494SRR21814496SRR21814498SRR21814500SRR21814501SRR21814502SRR21814504SRR21814505SRR21814506SRR21814508SRR21814514
411815004TGTTGAAAGTTAAACTTGAT-TAAAAGAATTTTACTCTAACSRR21814492SRR21814493SRR21814495SRR21814503
411815007TTGTTAGAGTAAAATTCTTT-TCAAGTTTAACTTTCAACACSRR21814491SRR21814496
411815008TGTTAGAGTAAAATTCTTTT-TCAAGTTTAACTTTCAACACSRR21814492SRR21814493SRR21814494SRR21814495
411815008TGTTAGAGTAAAATTCTTTT-ATCAAGTTTAACTTTCAACASRR21814496SRR21814498SRR21814500SRR21814501SRR21814502SRR21814503SRR21814504SRR21814505SRR21814506SRR21814508SRR21814514
414072586GGGAAAAATGTTATTTAATA-TATTAAATAACATTTTTCCCSRR21814487SRR21814494SRR21814496SRR21814498
414072595GGGAAAAATGTTATTTAATA-TATTAAATAACATTTTTCCCSRR21814487SRR21814494SRR21814496SRR21814498
415508108TGTTAATGCACGAATTAAAC-GTTTAATTCGTGCATTAACASRR21814496SRR21814501SRR21814505SRR21814506SRR21814516
415508112TGTTAATGCACGAATTAAAC-GTTTAATTCGTGCATTAACASRR21814496SRR21814501SRR21814505SRR21814506SRR21814516
417352297GAGAATATTACACGTAGAGG-CTAAACGTGTCACATTCCCTSRR21814501SRR21814515
417352305GGGAATGTGACACGTTTAGG-CCTCTACGTGTAATATTCTCSRR21814501SRR21814515
418388169TGTTAGAGTAAAATTCTTTT-ATCAAGTTTAACTTTCAACASRR21814500SRR21814501SRR21814502
418388173TGTTGAAAGTTAAACTTGAT-AAAAGAATTTTACTCTAACASRR21814500SRR21814501SRR21814502
52440397TAGTCCTGGGCGTTTGGGTA-GGGTATTTTGCCCAGGCCTASRR21814494SRR21814504
52440404TAGGCCTGGGCAAAATACCC-TACCCAAACGCCCAGGACTASRR21814494SRR21814504
57340023GAACTTTTATCACTTATGCC-GGCATAAGAGGTGAGCTCTCSRR21814501SRR21814512SRR21814520
57340031GAGAGCTCACCTCTTATGCC-GGCATAAGTGATAAAAGTTCSRR21814512SRR21814520
58320646AGGGAATTTAATGAAAAAAA-TTTTTTTCATTAAATTCCCTSRR21814487SRR21814503
58320652AGGGAATTTAATGAAAAAAA-TTTTTTTCATTAAATTCCCTSRR21814487SRR21814503
58676721AGGGAATTTAATGAAAAAAA-TTTTTTTCATTAAATTCCCTSRR21814487SRR21814503SRR21814508SRR21814510SRR21814511
58676727AGGGAATTTAATGAAAAAAA-TTTTTTTCATTAAATTCCCTSRR21814487SRR21814503SRR21814508SRR21814510SRR21814511
510370820TTAGGGAATTTAATGAAAAA-TTTTTTTCATTAAATTCCCASRR21814510SRR21814511
510686242TGTTGGTGCAGGAATTAGCA-GTTTGATTACAGAATCAACASRR21814492SRR21814493
510686246TGTTGATTCTGTAATCAAAC-TGCTAATTCCTGCACCAACASRR21814492SRR21814493
510761334TGATAAGTGTGTATTTTGCA-GACTTAAAAACCTATTATCASRR21814488SRR21814500SRR21814506SRR21814512SRR21814513
510761338TGATAATAGGTTTTTAAGTC-TGCAAAATACACACTTATCASRR21814488SRR21814500SRR21814506SRR21814512SRR21814513
511018952GAGAATATTACACTCTAAGA-CCTAAACGTGTCACATTCCCSRR21814495SRR21814507SRR21814513SRR21814514SRR21814516SRR21814518
511018960GGGAATGTGACACGTTTAGG-TCTTAGAGTGTAATATTCTCSRR21814495SRR21814507SRR21814513SRR21814514SRR21814516SRR21814518
511288941GATCTCTTATTTGAGAGAGT-TGTGGAATTCGACCCTTAAGSRR21814496SRR21814499SRR21814504SRR21814514SRR21814516SRR21814518
511288949ACTTAAGGGTCGAATTCCAC-CACTCTCTCAAATAAGAGATSRR21814488SRR21814491SRR21814496SRR21814499SRR21814504SRR21814516SRR21814518
511288950CTTAAGGGTCGAATTCCACA-ACTCTCTCAAATAAGAGATCSRR21814488SRR21814491SRR21814496SRR21814499SRR21814504SRR21814506SRR21814516SRR21814518SRR21814519
511675610TTGCGGTTTAAGTTCTTATA-ATTCTTACGCCTTTAAGATCSRR21814486SRR21814500
511727191AATCTTAAAAGCCTAAGTAG-TTAAGTATAAGAACTTAAACSRR21814487SRR21814519
511963553GCTACACCATCAAAGCTTTG-CCAAAGACTCATACGGAGTTSRR21814506SRR21814509
511995408TGTCGATCGACACCATCGCG-CAGAAGGGTGTCGATCGACASRR21814500SRR21814501
512186319TTGAAAGGCCCCGATCCGGA-TGAGGATCGCGGGCGTTACASRR21814492SRR21814493
513061178TGTTGGGGTCGGATTTGACC-TGCGAGTTTCGACTCTCACASRR21814496SRR21814502
513390707TGATAAGTGTGTATTTTGCA-GACTGAAAAACCTATTATCASRR21814499SRR21814510SRR21814518
513390711TGATAATAGGTTTTTCAGTC-TGCAAAATACACACTTATCASRR21814499SRR21814510SRR21814511SRR21814518
513881448TATTAGGGACAATGTCCCAC-GTGGGACATTGTCCCTAATASRR21814490SRR21814494SRR21814504
513881452TATTAGGGACAATGTCCCAC-GTGGGACATTGTCCCTAATASRR21814490SRR21814494SRR21814504
514547840TTGAAAGGCCCCGATCCGGA-TGAGGATCGCGGGCGTTACASRR21814492SRR21814493
514547843TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCASRR21814493SRR21814520
514556285TGTGGATGTCGGAATCCGCA-GGCCGAATCCGACATCCACASRR21814496SRR21814507SRR21814517
514556288TTGTGGATGTCGGATTCGGC-TGCGGATTCCGACATCCACASRR21814496SRR21814507SRR21814517
515558532CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGSRR21814494SRR21814518
515708706GAATAATCGTCTGGCCAGTC-GACACAAGAGATGATCCCTCSRR21814489SRR21814496SRR21814506SRR21814509
515708714GAGGGATCATCTCTTGTGTC-GACTGGCCAGACGATTATTCSRR21814489SRR21814496SRR21814506SRR21814509
515901664GAGAGCTCACCTCTTATGCC-GGCATAAGTGATAAAAGTTCSRR21814492SRR21814493SRR21814512
515901672GAACTTTTATCACTTATGCC-GGCATAAGAGGTGAGCTCTCSRR21814492SRR21814493SRR21814512
515951970TGTTATAAACAGAGAAAGAG-ATCCATCTTTATTCATAACASRR21814499SRR21814512SRR21814516
515951974TGTTATGAATAAAGATGGAT-CTCTTTCTCTGTTTATAACASRR21814499SRR21814512SRR21814516
516517824CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGSRR21814487SRR21814490
517077124GGAGAAACGGTCTATTTCCC-GGGAAATAGACCGTTTCTCCSRR21814492SRR21814493SRR21814499SRR21814515
517077133GGAGAAACGGTCTATTTCCC-GGGAAATAGACCGTTTCTCCSRR21814492SRR21814493SRR21814499SRR21814515
517541962CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTGSRR21814487SRR21814490
517541969CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGSRR21814487SRR21814490
517890009GGGAAAAATGTCGTTAAATC-GATTTAACGACATTTTTCCCSRR21814487SRR21814498SRR21814505
517890018GGGAAAAATGTCGTTAAATC-GATTTAACGACATTTTTCCCSRR21814487SRR21814498SRR21814505
520214297TGTTGGAGTAAGCTTGAAGC-TATATAGTTTGAATCAATATSRR21814510SRR21814511
520214301TATTGATTCAAACTATATAT-GCTTCAAGCTTACTCCAACASRR21814510SRR21814511
520364553TGTTGAAAGAATTGCATCAT-TTAACCAACTATTCTCTACASRR21814487SRR21814490SRR21814499SRR21814506
520364557TGTAGAGAATAGTTGGTTAA-ATGATGCAATTCTTTCAACASRR21814487SRR21814490SRR21814499
520523368TGTTATAAACAGAGAAAGAG-ATCCATCTTTATTCATAACASRR21814503SRR21814509
521150324TGTTATGAATAAAGATGGAT-CTCTTTCTCTGTTTATAACASRR21814491SRR21814492SRR21814493
521150328TGTTATAAACAGAGAAAGAG-ATCCATCTTTATTCATAACASRR21814492SRR21814493
521957656GGGAAAAATGTTGTTTTATA-TATAAAACAACATTTTTCCCSRR21814488SRR21814496SRR21814497SRR21814507SRR21814508SRR21814512
521957665GGGAAAAATGTTGTTTTATA-TATAAAACAACATTTTTCCCSRR21814488SRR21814496SRR21814497SRR21814507SRR21814508SRR21814512
523918572GGGAAAAAAGCCGAAAAAAC-GTTTTTTCGGCTTTTTTCCCSRR21814515SRR21814517
523918581GGGAAAAAAGCCGAAAAAAC-GTTTTTTCGGCTTTTTTCCCSRR21814515SRR21814517
524328213GTAAGATTTGCTTAGATTGA-GTTACTCTAGTAAATTTCCCSRR21814500SRR21814501SRR21814506SRR21814508SRR21814517
524328221GGGAAATTTACTAGAGTAAC-TCAATCTAAGCAAATCTTACSRR21814508SRR21814517
524694439TGTTGAAAGAATTGCATCAT-TTAACCAACTATTCTCTACASRR21814487SRR21814500SRR21814501
524694443TGTAGAGAATAGTTGGTTAA-ATGATGCAATTCTTTCAACASRR21814487SRR21814500SRR21814501
526746313GGGAATTTAATGAAAAAAAC-TTTTTTTCATTAAATTCCCTSRR21814495SRR21814516
526746314AGGGAATTTAATGAAAAAAA-TTTTTTTCATTAAATTCCCTSRR21814487SRR21814490SRR21814491SRR21814504SRR21814505SRR21814510SRR21814511
526746320AGGGAATTTAATGAAAAAAA-TTTTTTTCATTAAATTCCCTSRR21814487SRR21814490SRR21814491SRR21814504SRR21814505SRR21814510SRR21814511

Sample Information (Latorre M et al. 2022)

AccessionSample_IDCollection_YearLocationLatitudeLongitude
SRR21814486HB07291866Tuebingen48.52361649.0535531
SRR21814487HB07251888Tuebingen48.52361649.0535531
SRR21814488HB07221891Altburg48.66194318.6926366
SRR21814489HB07191890Tuebingen48.52361649.0535531
SRR21814490HB07181890Tuebingen48.52361649.0535531
SRR21814491HB07171826Alpirsbach48.34560218.4033079
SRR21814492HB08411875Freudenstadt_in_the_Black_Forest48.46377278.4111727
SRR21814493HB08401851Sulz_am_Neckar48.36175098.6314329
SRR21814494HB08301862near_Beimerstetten48.48406439.9836241
SRR21814495HB08281890Schramberg48.2254788.3852168
SRR21814496HB08261948Abtsgmuend48.893647110.0027636
SRR21814497HB07151828Esslingen48.74275849.3071685
SRR21814498HB08221936Hohentwiel47.76175158.8348709
SRR21814499HB08211874Winnenden48.87545719.3978478
SRR21814500HB08191928Langenau_near_Ulm48.72765538.0150864
SRR21814501HB08181928Langenau_near_Ulm48.72765538.0150864
SRR21814502HB08171934Gundelwangen_near_Bonndorf47.84261638.2864051
SRR21814503HB08141882Heidelberg49.40935828.694724
SRR21814504HB08081817Stuttgart_Moehringen48.77844859.1800132
SRR21814505HB07681894Todtnau47.83033787.9452378
SRR21814506HB07661846Monastery_forest_Hohenzollern47.972475110.3005044
SRR21814507HB07641905Mengen48.0497969.3316096
SRR21814508HB07131826Esslingen48.74275849.3071685
SRR21814509HB07591893Wohlmuthausen50.572724110.21353915
SRR21814510HB07571951Wendlingen50.80217377.7130698
SRR21814511HB07561951Wendlingen50.80217377.7130698
SRR21814512HB07541951District_of_Calw48.71533448.7381796
SRR21814513HB07521952Eberspiel_in_the_district_of_Calw48.74155068.6842699
SRR21814514HB07501957Boeblingen48.6849699.0113444
SRR21814515HB07491849near_Hohenheim48.71189.2113
SRR21814516HB07421953Lichtenstein48.419969139.26630222
SRR21814517HB07371937Tuebingen48.52361649.0535531
SRR21814518HB07321932Rastatt49.05329068.5245089
SRR21814519HB07111840NANANA
SRR21814520HB07021905Mellendorf_near_Buttlar52.54706759.7299326

Matrix of coexistence insertions of TEs

HB0702HB0711HB0713HB0715HB0717HB0718HB0719HB0722HB0725HB0729HB0732HB0737HB0742HB0749HB0750HB0752HB0754HB0756HB0757HB0759HB0764HB0766HB0768HB0808HB0814HB0817HB0818HB0819HB0821HB0822HB0826HB0828HB0830HB0840HB0841
HB0702224226221221
HB0711331336331322
HB0713824643552214422482632742261154
HB071582142252311625232452
HB071732347452422242223262417633
HB07182231113226323142413733242
HB07191343223834222923
HB072223444131727226722263722642922
HB0725167111312116422424622423222
HB072944243332442412217225122
HB073233252471321438446446249221143111052
HB07375222224224212314268422
HB074223554637121438593410142611191156866
HB074922232214343444236222211133224
HB0750222222828464424444526242483
HB0752123644546622561517832942
HB07546431724294628244264344
HB075641443264634422522545164322
HB0757222414222514231218122
HB0759212824443221433411444424
HB076424624322262106452211252216712
HB0766268314622211424681411341513844142498
HB07682223234422415432138477265331
HB08083656772926245423548163210396
HB081432241225534141111114222
HB0817222111257617665211
HB08181732326723111167212121373173014113664
HB08194236221111284118221630144321
HB082132422421449344684410113132232
HB08222121243212321463164437351
HB082623647992211615426461459151141372844
HB082815642235108638944247234233232111311
HB0830122322154823334143621622581154
HB084012532226244222291216131413555
HB084124322226424248242411455

Distance of pairs

PairCoexistent
insertions
HB0840 HB084155
HB0818 HB081930
HB0756 HB075725
HB0742 HB082615
HB0732 HB074214
HB0732 HB082114
HB0742 HB076614
HB0766 HB082614
HB0766 HB076813
HB0766 HB081813
HB0821 HB082613
HB0828 HB084013
HB0718 HB072511
HB0732 HB082611
HB0742 HB081811
HB0749 HB081811
HB0818 HB082611
HB0828 HB083011
HB0828 HB084111
HB0732 HB082810
HB0742 HB076410
HB0808 HB082110
HB0719 HB08269
HB0722 HB08269
HB0732 HB08089
HB0742 HB07549
HB0742 HB08219
HB0752 HB08289
HB0766 HB08409
HB0808 HB08269
HB0713 HB07158
HB0713 HB07668
HB0719 HB07598
HB0732 HB07508
HB0737 HB08288
HB0742 HB07508
HB0742 HB08308
HB0750 HB08288
HB0752 HB08198
HB0754 HB07668
HB0757 HB08218
HB0766 HB08198
HB0766 HB08418
HB0768 HB08088
HB0826 HB08308
HB0713 HB08187
HB0717 HB07257
HB0717 HB08267
HB0718 HB08087
HB0722 HB07327
HB0722 HB07427
HB0722 HB07547
HB0722 HB08087
HB0729 HB08187
HB0752 HB08187
HB0764 HB08287
HB0768 HB08177
HB0768 HB08187
HB0817 HB08187
HB0822 HB08267
HB0702 HB07546
HB0711 HB07666
HB0713 HB07256
HB0713 HB08086
HB0713 HB08266
HB0715 HB07646
HB0717 HB08086
HB0717 HB08286
HB0718 HB07426
HB0722 HB07526
HB0722 HB07666
HB0722 HB08196
HB0725 HB07566
HB0725 HB08186
HB0732 HB07566
HB0732 HB07646
HB0737 HB08266
HB0742 HB08086
HB0742 HB08286
HB0742 HB08406
HB0742 HB08416
HB0749 HB07646
HB0750 HB07526
HB0750 HB08186
HB0752 HB07546
HB0752 HB07666
HB0754 HB08266
HB0756 HB08216
HB0764 HB08266
HB0768 HB08226
HB0808 HB08176
HB0808 HB08306
HB0817 HB08196
HB0817 HB08226
HB0818 HB08306
HB0818 HB08406
HB0713 HB07375
HB0713 HB07425
HB0713 HB08405
HB0715 HB07425
HB0715 HB08085
HB0715 HB08285
HB0717 HB07325
HB0729 HB08285
HB0732 HB08305
HB0742 HB07525
HB0750 HB08145
HB0752 HB07645
HB0752 HB08085
HB0756 HB07685
HB0756 HB08145
HB0764 HB08085
HB0766 HB08175
HB0768 HB08265
HB0817 HB08265
HB0822 HB08305
HB0830 HB08405
HB0702 HB07294
HB0713 HB07224
HB0713 HB07294
HB0713 HB07544
HB0713 HB07564
HB0713 HB07644
HB0713 HB08194
HB0713 HB08414
HB0715 HB07224
HB0715 HB08264
HB0717 HB07224
HB0717 HB07294
HB0717 HB07424
HB0717 HB07564
HB0717 HB08214
HB0718 HB07564
HB0718 HB07644
HB0718 HB08284
HB0719 HB07324
HB0719 HB07664
HB0722 HB08214
HB0725 HB07574
HB0725 HB07684
HB0725 HB08144
HB0725 HB08224
HB0729 HB07494
HB0729 HB07524
HB0729 HB07564
HB0732 HB07524
HB0732 HB07544
HB0732 HB07574
HB0732 HB07594
HB0732 HB07684
HB0737 HB07494
HB0737 HB07594
HB0737 HB08214
HB0737 HB08304
HB0742 HB07594
HB0749 HB07504
HB0749 HB07524
HB0749 HB07564
HB0749 HB08414
HB0750 HB07544
HB0750 HB07564
HB0750 HB07644
HB0750 HB07664
HB0750 HB07684
HB0750 HB08084
HB0750 HB08214
HB0750 HB08264
HB0752 HB08404
HB0754 HB08194
HB0754 HB08214
HB0754 HB08284
HB0754 HB08404
HB0754 HB08414
HB0756 HB08084
HB0756 HB08284
HB0757 HB07684
HB0759 HB07664
HB0759 HB08144
HB0759 HB08214
HB0759 HB08264
HB0759 HB08284
HB0759 HB08304
HB0759 HB08414
HB0766 HB08084
HB0766 HB08214
HB0766 HB08224
HB0766 HB08304
HB0768 HB08144
HB0814 HB08284
HB0818 HB08224
HB0818 HB08414
HB0819 HB08224
HB0819 HB08264
HB0826 HB08404
HB0826 HB08414
HB0830 HB08414
HB0711 HB07173
HB0711 HB07223
HB0711 HB07323
HB0711 HB07423
HB0711 HB08083
HB0711 HB08213
HB0711 HB08263
HB0713 HB07323
HB0713 HB08143
HB0715 HB07543
HB0715 HB08183
HB0717 HB07183
HB0717 HB07663
HB0717 HB08403
HB0717 HB08413
HB0718 HB07293
HB0718 HB07493
HB0718 HB07523
HB0718 HB07683
HB0718 HB08183
HB0718 HB08193
HB0719 HB07223
HB0719 HB07423
HB0719 HB07563
HB0719 HB07643
HB0719 HB08303
HB0722 HB07683
HB0725 HB07293
HB0725 HB08283
HB0729 HB07323
HB0732 HB07493
HB0732 HB08223
HB0737 HB08183
HB0742 HB07493
HB0742 HB07563
HB0749 HB07593
HB0749 HB08213
HB0749 HB08283
HB0750 HB08303
HB0752 HB08223
HB0754 HB08303
HB0756 HB08303
HB0757 HB08143
HB0759 HB07683
HB0759 HB08083
HB0768 HB08283
HB0768 HB08303
HB0808 HB08183
HB0808 HB08223
HB0818 HB08283
HB0819 HB08283
HB0821 HB08223
HB0821 HB08403
HB0822 HB08283
HB0702 HB07182
HB0702 HB07222
HB0702 HB07422
HB0702 HB07492
HB0702 HB07642
HB0702 HB07662
HB0702 HB08222
HB0702 HB08262
HB0711 HB08402
HB0711 HB08412
HB0713 HB07172
HB0713 HB07492
HB0713 HB07502
HB0713 HB07572
HB0713 HB07592
HB0713 HB07682
HB0713 HB08172
HB0713 HB08212
HB0713 HB08222
HB0715 HB07182
HB0715 HB07292
HB0715 HB07322
HB0715 HB07502
HB0715 HB07682
HB0715 HB08172
HB0715 HB08192
HB0715 HB08302
HB0717 HB07372
HB0717 HB07492
HB0717 HB07502
HB0717 HB07522
HB0717 HB07572
HB0717 HB07592
HB0717 HB07642
HB0717 HB07682
HB0717 HB08182
HB0718 HB07322
HB0718 HB07372
HB0718 HB07502
HB0718 HB07572
HB0718 HB08212
HB0718 HB08302
HB0719 HB07492
HB0719 HB07502
HB0719 HB07682
HB0719 HB08142
HB0719 HB08212
HB0719 HB08282
HB0722 HB07372
HB0722 HB07492
HB0722 HB07502
HB0722 HB07562
HB0722 HB07592
HB0722 HB07642
HB0722 HB08142
HB0722 HB08182
HB0722 HB08222
HB0722 HB08282
HB0722 HB08302
HB0725 HB07372
HB0725 HB07642
HB0725 HB07662
HB0725 HB08082
HB0725 HB08192
HB0725 HB08212
HB0725 HB08262
HB0725 HB08302
HB0725 HB08402
HB0725 HB08412
HB0729 HB07422
HB0729 HB07542
HB0729 HB07642
HB0729 HB07662
HB0729 HB08192
HB0729 HB08262
HB0729 HB08402
HB0729 HB08412
HB0732 HB07372
HB0732 HB07662
HB0732 HB08142
HB0732 HB08182
HB0732 HB08412
HB0737 HB07502
HB0737 HB07542
HB0737 HB07642
HB0737 HB08082
HB0737 HB08222
HB0737 HB08402
HB0737 HB08412
HB0742 HB07682
HB0749 HB07572
HB0749 HB07662
HB0749 HB07682
HB0749 HB08082
HB0749 HB08142
HB0749 HB08302
HB0749 HB08402
HB0750 HB07592
HB0750 HB08172
HB0750 HB08192
HB0750 HB08222
HB0752 HB07562
HB0752 HB07572
HB0752 HB08262
HB0752 HB08412
HB0754 HB07642
HB0754 HB08182
HB0754 HB08222
HB0756 HB07592
HB0756 HB07642
HB0756 HB08402
HB0756 HB08412
HB0757 HB08082
HB0757 HB08182
HB0757 HB08282
HB0757 HB08402
HB0759 HB08402
HB0764 HB07682
HB0764 HB08172
HB0764 HB08182
HB0764 HB08402
HB0766 HB08282
HB0768 HB08192
HB0808 HB08192
HB0814 HB08302
HB0814 HB08402
HB0814 HB08412
HB0817 HB08282
HB0819 HB08302
HB0821 HB08282
HB0821 HB08302
HB0821 HB08412
HB0826 HB08282
HB0702 HB08181
HB0702 HB08401
HB0711 HB07251
HB0711 HB08221
HB0713 HB07521
HB0713 HB08281
HB0713 HB08301
HB0715 HB07191
HB0715 HB07561
HB0715 HB07591
HB0717 HB08221
HB0718 HB07221
HB0718 HB07541
HB0718 HB07661
HB0722 HB07251
HB0725 HB07321
HB0725 HB07421
HB0725 HB07491
HB0729 HB07571
HB0729 HB08141
HB0729 HB08301
HB0732 HB08191
HB0737 HB07661
HB0737 HB08191
HB0742 HB08191
HB0742 HB08221
HB0749 HB08191
HB0752 HB07681
HB0752 HB08171
HB0756 HB08181
HB0757 HB07661
HB0757 HB08171
HB0757 HB08191
HB0757 HB08221
HB0759 HB07641
HB0759 HB08171
HB0759 HB08181
HB0764 HB07661
HB0764 HB08191
HB0764 HB08301
HB0766 HB08141
HB0768 HB08401
HB0808 HB08141
HB0814 HB08171
HB0814 HB08181
HB0814 HB08191
HB0814 HB08221
HB0814 HB08261
HB0817 HB08301
HB0817 HB08401
HB0818 HB08211
HB0819 HB08211
HB0819 HB08401
HB0822 HB08401

List of detected TE candidates by TEF

No.TE Head-TailTE NameChrPositionAccession
1AAAAAAGAAGCAAATACTCT-AGAACAAAAACAGAAAAAAA513437808SRR13608004
1AAAAAAGAAGCAAATACTCT-AGAACAAAAACAGAAAAAAA513437809SRR21814505
2AAAAAATATATTCATTTCGG-AGGATTTTTCCAAGTTCCAC23609230SRR13608004
2AAAAAATATATTCATTTCGG-AGGATTTTTCCAAGTTCCAC23609910SRR21814516
3AAAAAATGGGTCGGGTTGTT-ATATTTAATTATATTTTTTT113507801SRR21814507
3AAAAAATGGGTCGGGTTGTT-ATATTTAATTATATTTTTTT113667535SRR21814507
4AAAAAATTGAAAAATTTCAG-TTCATCTAAGGCATAGAAAA114124692SRR21814491
4AAAAAATTGAAAAATTTCAG-TTCATCTAAGGCATAGAAAA512520406SRR21814491
5AAAAACAACAACAACAACAA-AACAACAACAACATCAACAA2650163SRR21814503
5AAAAACAACAACAACAACAA-AACAACAACAACATCAACAA52845645SRR21814503
6AAAAACAATGTCCGAACATA-GATTTGATACATGCAAAATA313687531SRR13608004
6AAAAACAATGTCCGAACATA-GATTTGATACATGCAAAATA313788903SRR13608004
7AAAAACCTATTATCAATTTG-ATGATAGTGCTTTAGGATAA113920735SRR21814504SRR21814511
7AAAAACCTATTATCAATTTG-ATGATAGTGCTTTAGGATAA41763903SRR21814504SRR21814511
8AAAAACTAACCAACCTTCTT-ACAACAAGTCATATTCGACT43966052SRR13608004
8AAAAACTAACCAACCTTCTT-ACAACAAGTCATATTCGACT511732466SRR13608004
9AAAAAGCATAAACATAGTAA-GAATGAAACAAACAACATAT113780650SRR13608004
9AAAAAGCATAAACATAGTAA-GAATGAAACAAACAACATAT113780651SRR21814511
10AAAAAGCCTAAGTAGTGTTT-GAACTTAAACCGCAACCCAA511702855SRR21814506
10AAAAAGCCTAAGTAGTGTTT-GAACTTAAACCGCAACCCAA512027278SRR13608004
11AAAAAGCTTGGTTAGTTTTT-ACACCATCAAAGCTTTGAGA114362498SRR13608004
11AAAAAGCTTGGTTAGTTTTT-ACACCATCAAAGCTTTGAGA42961260SRR21814518
12AAAAAGTAAAGTAGTGCTTC-AACTAGAACCTCAACGAGAT115088347SRR13608004
12AAAAAGTAAAGTAGTGCTTC-AACTAGAACCTCAACGAGAT115222738SRR13608004
13AAAAAGTAACCAATTAAAAT-ACGAAATACATTATTAATTT311200913SRR21814510
13AAAAAGTAACCAATTAAAAT-ACGAAATACATTATTAATTT525264697SRR21814510
14AAAAATAGATTTAAAAAAAA-CATGAAAAATATTATAACGG114299428SRR21814510
14AAAAATAGATTTAAAAAAAA-CATGAAAAATATTATAACGG212093910SRR21814510
15AAAAATATATTCATTTTGGT-TCAAGGATTTTTCCAAGTTC23614028SRR21814503
15AAAAATATATTCATTTTGGT-TCAAGGATTTTTCCAAGTTC23635265SRR21814503
16AAAAATCACGGGTTTACGTT-CACGGGTTTACGTTTTTGAC113166554SRR21814515
16AAAAATCACGGGTTTACGTT-CACGGGTTTACGTTTTTGAC48803498SRR21814515
17AAAACACTAACCAACCTTCT-ACACATGACATCAAGTCATA114487368SRR21814505
17AAAACACTAACCAACCTTCT-ACACATGACATCAAGTCATA42923091SRR21814505
18AAAACACTAACCAAGCTTCA-CATGACATCAAATCATATTC23620076SRR21814493
18AAAACACTAACCAAGCTTCA-CATGACATCAAATCATATTC511974701SRR21814493
19AAAACACTAACCAAGCTTCT-CATGACATCTAGTCATATTT115171051SRR13608004
19AAAACACTAACCAAGCTTCT-CATGACATCTAGTCATATTT42977582SRR21814487
20AAAACACTAACCAAGCTTCT-TACACATGACATCAAGTCAT23717787SRR21814507
20AAAACACTAACCAAGCTTCT-TACACATGACATCAAGTCAT511729977SRR13608004
21AAAACATGATAACAACAGAG-GAAGAAAGCATAAACGTTGA114924751SRR21814495
21AAAACATGATAACAACAGAG-GAAGAAAGCATAAACGTTGA513327714SRR21814495
22AAAACCAAAAACACAAACCA-CAAAAATAAACGTTAATACG113772907SRR13608004
22AAAACCAAAAACACAAACCA-CAAAAATAAACGTTAATACG113772908SRR21814514
23AAAACCTAAGTAGTGTTTCC-AACTTAAACCGCAACCAGAT115082079SRR21814510
23AAAACCTAAGTAGTGTTTCC-AACTTAAACCGCAACCAGAT23618539SRR21814510
24AAAACGTAAATCCGTGATTT-AAACGTAAACCCGTGATTTT113166548SRR21814499
24AAAACGTAAATCCGTGATTT-AAACGTAAACCCGTGATTTT317203335SRR21814499
25AAAACTAACCAACCTTCTTC-CACATGACATCAAGTCATAT114581891SRR21814517
25AAAACTAACCAACCTTCTTC-CACATGACATCAAGTCATAT43950822SRR21814517
26AAAACTAGATAAAAACTTCT-AAAAAGTCTAGAACACAAGG114430133SRR21814507
26AAAACTAGATAAAAACTTCT-AAAAAGTCTAGAACACAAGG312582105SRR21814507
27AAAACTCATATGGACTTTGG-CATTGTTAGAAGATACAAAG23615332SRR13608004
27AAAACTCATATGGACTTTGG-CATTGTTAGAAGATACAAAG23617280SRR13608004
28AAAAGAAGCTAAAACCAACA-AACACTTATACCCAATTTCT114660636SRR21814511
28AAAAGAAGCTAAAACCAACA-AACACTTATACCCAATTTCT114684116SRR21814511
29AAAAGAAGGTTGGAGATCGG-ACCATAAAAGCTTTAAGAAG23606155SRR21814503
29AAAAGAAGGTTGGAGATCGG-ACCATAAAAGCTTTAAGAAG511726573SRR21814503
30AAAAGACTCATATGGACTTT-TCTTTGTTAGAAGAAACAAA115083179SRR13608004
30AAAAGACTCATATGGACTTT-TCTTTGTTAGAAGAAACAAA313592369SRR21814495
31AAAAGATTTACAAGAGATTT-TTTACAAGGGATTTTAAAAG116597244SRR21814508
31AAAAGATTTACAAGAGATTT-TTTACAAGGGATTTTAAAAG313341757SRR21814508
32AAAAGCAAGAAGAAGCTTGG-CTTTGGCTACACCATGAAAA115437861SRR21814505
32AAAAGCAAGAAGAAGCTTGG-CTTTGGCTACACCATGAAAA43042625SRR21814505
33AAAAGCTTTGAGAAGCAAGA-ACATGGACTTTGGCTACACC23615361SRR13608004
33AAAAGCTTTGAGAAGCAAGA-ACATGGACTTTGGCTACACC511729046SRR13608004
34AAAAGCTTTGAGAAGCAAGA-CACATGGACTTTGGCTACAC23615361SRR13608004
34AAAAGCTTTGAGAAGCAAGA-CACATGGACTTTGGCTACAC511729046SRR13608004
35AAAAGGAAGCTAAGGACGAT-CATTTTGGAGCAAAAGCTAA511317564SRR21814503
35AAAAGGAAGCTAAGGACGAT-CATTTTGGAGCAAAAGCTAA512322919SRR21814503
36AAAAGGTTGGTTAGTGTTTT-AATGAAAGCTTTGAGAAGCA23618631SRR13608004
36AAAAGGTTGGTTAGTGTTTT-AATGAAAGCTTTGAGAAGCA313590995SRR13608004
37AAAAGGTTGGTTAGTGTTTT-CATAAAAGCTTTGAGAAGCA23619342SRR13608004
37AAAAGGTTGGTTAGTGTTTT-CATAAAAGCTTTGAGAAGCA313590995SRR13608004
38AAAAGTTAGAGATAGATTAG-ATACAATGCATTTGACTAAT114659466SRR21814487
38AAAAGTTAGAGATAGATTAG-ATACAATGCATTTGACTAAT115010825SRR13608004
39AAAATCAAGAGAATTTTTTA-TCTAAAATCTCATATTTTAT122776058SRR21814510
39AAAATCAAGAGAATTTTTTA-TCTAAAATCTCATATTTTAT125594439SRR21814510
40AAAATCACGGGTTTACGTTT-ACGGATTTACGTTTTTGGCG110526748SRR21814503SRR21814514
40AAAATCACGGGTTTACGTTT-ACGGATTTACGTTTTTGGCG116124908SRR21814503SRR21814514
41AAAATCCGTATGAGTCTTTG-TCAAAGCTTTCATGATGTAG23615173SRR21814513
41AAAATCCGTATGAGTCTTTG-TCAAAGCTTTCATGATGTAG511730460SRR21814513
42AAAATCTATCGGGTCCGAGG-CCAGGACGAGGAATCGTCGA21054SRR13608004
42AAAATCTATCGGGTCCGAGG-CCAGGACGAGGAATCGTCGA210187SRR13608004
43AAAATGCGAACTAGAACTAC-AGCGCCCACCTAGTCCTATC114180622SRR21814500
43AAAATGCGAACTAGAACTAC-AGCGCCCACCTAGTCCTATC511084523SRR21814500
44AAAATTCCGGAACCGGGACG-AGCGCGAACTTCGAAAGGGG27978SRR13608004
44AAAATTCCGGAACCGGGACG-AGCGCGAACTTCGAAAGGGG314201707SRR21814511
45AAACACAATTTAACATTTTC-CAAAAAGATTTCACATTTTT216626316SRR21814503
45AAACACAATTTAACATTTTC-CAAAAAGATTTCACATTTTT514023037SRR13608004
46AAACACTAACCAACCTTCTT-AAGAAGGTTGGTTAGTGTTT27989SRR21814497
46AAACACTAACCAACCTTCTT-AAGAAGGTTGGTTAGTGTTT27990SRR21814497
47AAACACTACTTAGGCTTATA-GGCTTTGTATCTTCTAACAA511667314SRR21814501
47AAACACTACTTAGGCTTATA-GGCTTTGTATCTTCTAACAA512048334SRR13608004
48AAACACTACTTAGGCTTATA-TTCGGCTTTGTATCTTCTAA114484324SRR21814510
48AAACACTACTTAGGCTTATA-TTCGGCTTTGTATCTTCTAA511975149SRR13608004
49AAACAGCAACCGGATCTTAA-TATATGATTGAGTATAAGAA114545486SRR13608004
49AAACAGCAACCGGATCTTAA-TATATGATTGAGTATAAGAA115082238SRR13608004
50AAACATCAATGGAGCCATCA-TTCGTGTTCTAACGCATGAA41457111SRR21814493
50AAACATCAATGGAGCCATCA-TTCGTGTTCTAACGCATGAA44782339SRR21814493
51AAACCAACCTTCTTCTTGCT-AGTCATATTTGACTACAAAA313587222SRR13608004
51AAACCAACCTTCTTCTTGCT-AGTCATATTTGACTACAAAA511709276SRR13608004
52AAACCATAAACCCTAAACCC-CTAAACCCTAAACCCTAAAC115091412SRR21814488SRR21814498
52AAACCATAAACCCTAAACCC-CTAAACCCTAAACCCTAAAC43195818SRR13608004
53AAACCATAAACCCTAAACCC-TAAACCCTAAACCCTAAACC115089604SRR13608004
53AAACCATAAACCCTAAACCC-TAAACCCTAAACCCTAAACC115091412SRR21814502
53AAACCATAAACCCTAAACCC-TAAACCCTAAACCCTAAACC43195818SRR13608004
54AAACCCTAAACCCTAAACCC-CTAAACCCTAAACCCTAAAC115089063SRR13608004
54AAACCCTAAACCCTAAACCC-CTAAACCCTAAACCCTAAAC115149002SRR21814495
54AAACCCTAAACCCTAAACCC-CTAAACCCTAAACCCTAAAC115424515SRR21814495
54AAACCCTAAACCCTAAACCC-CTAAACCCTAAACCCTAAAC43194810SRR21814495
55AAACCTAAACTTTCTTTCAA-ATTAAAGCAGTTAACCCGAA113775419SRR13608004
55AAACCTAAACTTTCTTTCAA-ATTAAAGCAGTTAACCCGAA114505456SRR21814493
56AAACGCTAACCAAAATTTTT-CATCTACTCATATTTCACTC115100209SRR21814487
56AAACGCTAACCAAAATTTTT-CATCTACTCATATTTCACTC115238533SRR21814487
57AAACTAGGGGAAGGTTTAAA-GTTTGCTAATTCTCGGAAAC22649SRR13608004
57AAACTAGGGGAAGGTTTAAA-GTTTGCTAATTCTCGGAAAC314196616SRR21814486
58AAAGAACTTAAACCGCAACC-TAACTTGATGTCATGTGTAT23602542SRR21814515
58AAAGAACTTAAACCGCAACC-TAACTTGATGTCATGTGTAT43975739SRR21814515
59AAAGAAGAAGCTTGGTTAGT-AAACCATCAAAGCTTTGAGA114511308SRR13608004
59AAAGAAGAAGCTTGGTTAGT-AAACCATCAAAGCTTTGAGA115084462SRR13608004
59AAAGAAGAAGCTTGGTTAGT-AAACCATCAAAGCTTTGAGA511660255SRR13608004
60AAAGAATCATATGGACTTTG-CCCTTGTTAGAAGATACAAA42920346SRR13608004
60AAAGAATCATATGGACTTTG-CCCTTGTTAGAAGATACAAA43969641SRR13608004
61AAAGACTCATATGGACTTTG-ATGTTTCCTTGTTAGAAGAT42960143SRR13608004
61AAAGACTCATATGGACTTTG-ATGTTTCCTTGTTAGAAGAT43975493SRR21814509
62AAAGAGAAGGACCCAAAAGA-GATGGTGATCAAGAGAAGGA34928760SRR21814505
62AAAGAGAAGGACCCAAAAGA-GATGGTGATCAAGAGAAGGA311410703SRR21814505
63AAAGCCAGTGGCGCGAAGCT-CTCCCGCCGTTTACCCGCGC28360SRR13608004
63AAAGCCAGTGGCGCGAAGCT-CTCCCGCCGTTTACCCGCGC29202SRR13608004
64AAAGCTTTGATAGTGTAGCC-ACTAACCAACCTTCTTCTTG511672934SRR13608004
64AAAGCTTTGATAGTGTAGCC-ACTAACCAACCTTCTTCTTG511757057SRR21814503
65AAAGGTCAAGAGACAAAGAT-GCATCATCAAAGAACTCATT113776112SRR21814509
65AAAGGTCAAGAGACAAAGAT-GCATCATCAAAGAACTCATT43263275SRR13608004
66AAAGTCCATATGAGTCTTTG-CAAAGACTCATATGGACTTT28085SRR21814487
66AAAGTCCATATGAGTCTTTG-CAAAGACTCATATGGACTTT28093SRR21814487
67AAATAAAAGTACAATATATC-CAATATATCATCTCAAAAAT26897366SRR13608004
67AAATAAAAGTACAATATATC-CAATATATCATCTCAAAAAT26897367SRR21814503SRR21814505
68AAATACAAAGACAAAGACTC-AAAGTAGTGTTTCCTTGTTA42953734SRR13608004
68AAATACAAAGACAAAGACTC-AAAGTAGTGTTTCCTTGTTA42957647SRR13608004
69AAATACTTAGGCTTTTAAGA-GTCTTTGTATCTTCTAACAA511755393SRR13608004
69AAATACTTAGGCTTTTAAGA-GTCTTTGTATCTTCTAACAA511964931SRR13608004
70AAATAGCATACATAGGATTA-TAATCCTATGTATGCTATTT112724720SRR13608004
70AAATAGCATACATAGGATTA-TAATCCTATGTATGCTATTT112724722SRR13608004
71AAATATGACTAGATGTCATA-AGAAGGTTGGTTAGTGTTTT114362293SRR21814488
71AAATATGACTAGATGTCATA-AGAAGGTTGGTTAGTGTTTT511915582SRR21814488
72AAATCATTTTCTGAAATTTT-TACATGAACACTCTGTTTTT23866451SRR21814500
72AAATCATTTTCTGAAATTTT-TACATGAACACTCTGTTTTT24598494SRR13608004
73AAATGAGTAAAATATAGTGT-AAGCTAAATGATGATAAACA114100256SRR21814486
73AAATGAGTAAAATATAGTGT-AAGCTAAATGATGATAAACA315118301SRR13608004
74AAATGTGTCACAATCCAATG-TAGATTTGTTAGTGTTTCTA114713493SRR21814512
74AAATGTGTCACAATCCAATG-TAGATTTGTTAGTGTTTCTA114935591SRR21814512
75AAATTGTATCCTTGTTAGAA-AAACCGCAATCGGATCTTAA115082087SRR21814488
75AAATTGTATCCTTGTTAGAA-AAACCGCAATCGGATCTTAA43952881SRR21814488
76AAATTTTAAAACAGACATAT-ATATGTCTGTTTTAAAATTT115960260SRR13608004
76AAATTTTAAAACAGACATAT-ATATGTCTGTTTTAAAATTT115960261SRR13608004
77AACAAAACAAAACAAAAAGA-CAAAACAAAACAAAACAAAA33623870SRR21814503
77AACAAAACAAAACAAAAAGA-CAAAACAAAACAAAACAAAA56033734SRR21814503
78AACAAACCTTCTTCTTGCTT-GTAATATTCGACTCCAAAAC114362484SRR13608004
78AACAAACCTTCTTCTTGCTT-GTAATATTCGACTCCAAAAC115587990SRR13608004
78AACAAACCTTCTTCTTGCTT-GTAATATTCGACTCCAAAAC43967162SRR13608004
79AACAACAACAACAACAACTA-ACAACAACAACAACAACAAC19973185SRR21814510
79AACAACAACAACAACAACTA-ACAACAACAACAACAACAAC3301681SRR21814510
80AACAACAACAACAACACAGA-CAACAACAACAACAACAACA18244370SRR21814497
80AACAACAACAACAACACAGA-CAACAACAACAACAACAACA218329066SRR21814497
81AACAAGATCTTAAAAGCCTA-TTAAGTATAAGAACTTAAAC114484711SRR21814506
81AACAAGATCTTAAAAGCCTA-TTAAGTATAAGAACTTAAAC43966172SRR13608004
82AACAAGTAGTTTTGTTGGTT-AACCAACAAAACTACTTGTT23187896SRR13608004
82AACAAGTAGTTTTGTTGGTT-AACCAACAAAACTACTTGTT23187905SRR13608004
83AACAATTTATTTTTTAAAGT-ATTTTAACCCGCGGTACACC318633972SRR21814500
83AACAATTTATTTTTTAAAGT-ATTTTAACCCGCGGTACACC319529735SRR13608004
84AACACGATCTTATAAGCCTA-TTAAGTATAAGAACTTAAAC23618528SRR13608004
84AACACGATCTTATAAGCCTA-TTAAGTATAAGAACTTAAAC43977502SRR13608004
85AACATGACATCAAGTCATAT-AGTTTAAGTTCTTATACTCA43045589SRR13608004
85AACATGACATCAAGTCATAT-AGTTTAAGTTCTTATACTCA512028653SRR13608004
86AACCAAATCTAAGTGCCACT-TATCCCTAAACAACAAGTTC114366325SRR21814495
86AACCAAATCTAAGTGCCACT-TATCCCTAAACAACAAGTTC115704485SRR21814495
87AACCAAATCTTAAAAGCCTA-GGAGTATAAGAACTTAAACC115082067SRR13608004
87AACCAAATCTTAAAAGCCTA-GGAGTATAAGAACTTAAACC511705324SRR13608004
87AACCAAATCTTAAAAGCCTA-GGAGTATAAGAACTTAAACC511705501SRR13608004
87AACCAAATCTTAAAAGCCTA-GGAGTATAAGAACTTAAACC511727364SRR13608004
88AACCAACCTTCTTCTTGCTT-ATCAAGTCATATTCGACTCC313641410SRR21814489
88AACCAACCTTCTTCTTGCTT-ATCAAGTCATATTCGACTCC42965189SRR21814489
89AACCAAGATTTTTCTTGCTT-TCATATTCGACTCCAAAACA115094095SRR21814505
89AACCAAGATTTTTCTTGCTT-TCATATTCGACTCCAAAACA115429944SRR21814505
90AACCAGATCTTAAAGGCGTA-TGAGTATAAGAACTTAAAAC23663077SRR21814495
90AACCAGATCTTAAAGGCGTA-TGAGTATAAGAACTTAAAAC43965996SRR21814495
91AACCCGAAACCGTAAACCTT-TAAACCCTAACCCCTGAACC115093123SRR21814513
91AACCCGAAACCGTAAACCTT-TAAACCCTAACCCCTGAACC115197404SRR21814513
92AACCCGTGATTTTCCCGCCA-GTGATTTTCCCGCCAAAAAC111286944SRR21814496
92AACCCGTGATTTTCCCGCCA-GTGATTTTCCCGCCAAAAAC21371127SRR21814496
92AACCCGTGATTTTCCCGCCA-GTGATTTTCCCGCCAAAAAC316353545SRR21814496
93AACCCTAAACCCTAAACCAT-TTAAACCTAAACCCTAAACC115160446SRR21814514
93AACCCTAAACCCTAAACCAT-TTAAACCTAAACCCTAAACC115427973SRR21814514
94AACCCTAAACCCTAAACCCT-ATCTAACCCTAAACCCTAAA115136323SRR21814490
94AACCCTAAACCCTAAACCCT-ATCTAACCCTAAACCCTAAA115200242SRR21814490
94AACCCTAAACCCTAAACCCT-ATCTAACCCTAAACCCTAAA115200249SRR21814490
95AACCCTAAACCTTAAACCCT-AAACCCTAAACCCTAAAACC115089586SRR21814509
95AACCCTAAACCTTAAACCCT-AAACCCTAAACCCTAAAACC115436566SRR21814509
96AACTATTTAAAACAAAAAAA-AAAATTTGAAATAGATTTCG117605743SRR21814495
96AACTATTTAAAACAAAAAAA-AAAATTTGAAATAGATTTCG119741814SRR21814495
97AACTTGGAAAAATCCTTGAG-AATATATTTTTCCAAAAGGT23610776SRR13608004
97AACTTGGAAAAATCCTTGAG-AATATATTTTTCCAAAAGGT23698316SRR13608004
98AACTTTCAAATTTGGAACGA-GAAAAAATGTCAAAAAAATC2176804SRR21814508
98AACTTTCAAATTTGGAACGA-GAAAAAATGTCAAAAAAATC211267240SRR21814508
99AAGAAAATTTCACGTTATAA-GCTACTGTGTGCAATTTACC117528690SRR21814515
99AAGAAAATTTCACGTTATAA-GCTACTGTGTGCAATTTACC27024573SRR21814515
100AAGAAAGTTTTGTTGGTTTT-AACACTAACAAATCTATTTA114933411SRR13608004
100AAGAAAGTTTTGTTGGTTTT-AACACTAACAAATCTATTTA114936263SRR13608004
101AAGAAATACTACTTAGGCTT-TTTGTCTTTGTATCTTCTAA23622828SRR13608004
101AAGAAATACTACTTAGGCTT-TTTGTCTTTGTATCTTCTAA511733943SRR21814489
102AAGAAATTTTCACAAAAGTG-GTGTGGCCTGCAATTTACCC113824186SRR21814508
102AAGAAATTTTCACAAAAGTG-GTGTGGCCTGCAATTTACCC35621236SRR21814508
103AAGAAATTTTCACAAAAGTG-TGTGGCCTGCAATTTACCCT118222053SRR21814496SRR21814505
103AAGAAATTTTCACAAAAGTG-TGTGGCCTGCAATTTACCCT119093770SRR21814505
103AAGAAATTTTCACAAAAGTG-TGTGGCCTGCAATTTACCCT121177613SRR21814494SRR21814501SRR21814504
103AAGAAATTTTCACAAAAGTG-TGTGGCCTGCAATTTACCCT121177893SRR21814505
103AAGAAATTTTCACAAAAGTG-TGTGGCCTGCAATTTACCCT122116990SRR21814494SRR21814496SRR21814517
103AAGAAATTTTCACAAAAGTG-TGTGGCCTGCAATTTACCCT21400069SRR21814501SRR21814517
103AAGAAATTTTCACAAAAGTG-TGTGGCCTGCAATTTACCCT35621236SRR21814515SRR21814517
103AAGAAATTTTCACAAAAGTG-TGTGGCCTGCAATTTACCCT315842971SRR21814504
103AAGAAATTTTCACAAAAGTG-TGTGGCCTGCAATTTACCCT316922125SRR21814515
103AAGAAATTTTCACAAAAGTG-TGTGGCCTGCAATTTACCCT318226451SRR21814517
103AAGAAATTTTCACAAAAGTG-TGTGGCCTGCAATTTACCCT322230579SRR21814494SRR21814501
104AAGAACTTCGGCTTCACCAT-TTTATACGATTCAAAACCAA115264031SRR21814495
104AAGAACTTCGGCTTCACCAT-TTTATACGATTCAAAACCAA43196041SRR21814495
105AAGAAGAAGAAGAAGAAGAA-GATCTAAGAAGAAGAAGAAG1598616SRR21814503
105AAGAAGAAGAAGAAGAAGAA-GATCTAAGAAGAAGAAGAAG120834407SRR21814503
106AAGAAGCTTGGTTAGTGTTT-ACACCATTAAAGCTTTGAGA115599787SRR21814519
106AAGAAGCTTGGTTAGTGTTT-ACACCATTAAAGCTTTGAGA23618629SRR13608004
107AAGAAGCTTGGTTAGTGTTT-CACAATCAAAGCTTTGAGAA115167269SRR13608004
107AAGAAGCTTGGTTAGTGTTT-CACAATCAAAGCTTTGAGAA115437693SRR13608004
107AAGAAGCTTGGTTAGTGTTT-CACAATCAAAGCTTTGAGAA511958508SRR13608004
108AAGAAGGTTGGTTAGTGTTT-AACATGAAAGCTTTGAGAAG115084117SRR21814492
108AAGAAGGTTGGTTAGTGTTT-AACATGAAAGCTTTGAGAAG312958756SRR21814492
109AAGCAAGAAGAAGATTGGAG-GGCTACACCATAAAAGCTTT115085697SRR21814503
109AAGCAAGAAGAAGATTGGAG-GGCTACACCATAAAAGCTTT23615719SRR21814503
110AAGCAAGAAGAAGCTTGGTT-AACCAAGCTTCTTCTTGCTT512045631SRR21814503
110AAGCAAGAAGAAGCTTGGTT-AACCAAGCTTCTTCTTGCTT512045638SRR21814503
111AAGCAATTTTTGTTGGTTTT-AGAAACACTAAAAAATCTAT114933887SRR21814511
111AAGCAATTTTTGTTGGTTTT-AGAAACACTAAAAAATCTAT44062528SRR21814511
112AAGCCAAAGACTCATATGGA-GTAGTGTTTCCTTGTTAGAA511726518SRR21814509
112AAGCCAAAGACTCATATGGA-GTAGTGTTTCCTTGTTAGAA511955504SRR13608004
112AAGCCAAAGACTCATATGGA-GTAGTGTTTCCTTGTTAGAA512052786SRR13608004
113AAGCCAGTGGCGCGAAGCTA-CTCCCGCCGTTTACCCGCGC28359SRR13608004
113AAGCCAGTGGCGCGAAGCTA-CTCCCGCCGTTTACCCGCGC29203SRR13608004
114AAGCTAAAGTAGGATTTAGG-CTAGAACCGCAACCGGATTT115096483SRR21814496
114AAGCTAAAGTAGGATTTAGG-CTAGAACCGCAACCGGATTT115245152SRR21814496
115AAGCTTGGTTAGTGTTTTGG-AACCATCAAAGCTTTGAGAA43043679SRR13608004
115AAGCTTGGTTAGTGTTTTGG-AACCATCAAAGCTTTGAGAA511963940SRR13608004
115AAGCTTGGTTAGTGTTTTGG-AACCATCAAAGCTTTGAGAA512054798SRR13608004
116AAGGAAAAGATCGGAAGAGC-CTTTATCTTTGTATCTTTTA43965605SRR21814508
116AAGGAAAAGATCGGAAGAGC-CTTTATCTTTGTATCTTTTA43968666SRR21814508
117AAGTAAATAGCTTTGTTAGT-ACCAACAAAACTTGCTTAGA114602950SRR21814505
117AAGTAAATAGCTTTGTTAGT-ACCAACAAAACTTGCTTAGA114942431SRR21814505
118AAGTAATTGCTTATTGTATG-ATGTTATTAGAAAAAATATT110598203SRR13608004
118AAGTAATTGCTTATTGTATG-ATGTTATTAGAAAAAATATT22240695SRR13608004
119AAGTATCACATGCCAAGTTT-GTCGGAGGGCTCTCTTTGGG313592773SRR21814492
119AAGTATCACATGCCAAGTTT-GTCGGAGGGCTCTCTTTGGG313840387SRR21814492
120AAGTCCGTATGAGTCTTTGG-TCAAAGCTTTGATGGCGTAG511660103SRR21814501
120AAGTCCGTATGAGTCTTTGG-TCAAAGCTTTGATGGCGTAG512058852SRR21814501
121AAGTGTTTAGACAACACTTA-TATAAGAGTTAGAGATGTAT114609629SRR13608004
121AAGTGTTTAGACAACACTTA-TATAAGAGTTAGAGATGTAT114951922SRR13608004
122AAGTTCTTATACTCAATCAT-AGCTTCCGGAATCCGGTTGC114510706SRR21814505
122AAGTTCTTATACTCAATCAT-AGCTTCCGGAATCCGGTTGC312959449SRR21814505
123AAGTTGTCAATCCAAATGGG-AATCATATCGTTGTAGTACT113644611SRR21814488
123AAGTTGTCAATCCAAATGGG-AATCATATCGTTGTAGTACT113712442SRR13608004
124AAGTTTGAGGGAATTGATAA-GTTTACTTGAGGGCAAGCAA113776403SRR21814504
124AAGTTTGAGGGAATTGATAA-GTTTACTTGAGGGCAAGCAA113917168SRR21814504
125AAGTTTGGGGAAGTTGATAA-ATTTGCTTGAGGGCAAGCAA113917168SRR13608004
125AAGTTTGGGGAAGTTGATAA-ATTTGCTTGAGGGCAAGCAA512212325SRR21814517
126AAGTTTTAAAAGGATTTACA-CAAGATTTACAAGAGTTTTT113905791SRR21814519
126AAGTTTTAAAAGGATTTACA-CAAGATTTACAAGAGTTTTT116722819SRR13608004
127AATAAATCTGTCTCTTATAC-TGTGTATAAGAGACAGACAT18091614SRR13608004
127AATAAATCTGTCTCTTATAC-TGTGTATAAGAGACAGACAT24844106SRR13608004
127AATAAATCTGTCTCTTATAC-TGTGTATAAGAGACAGACAT218648237SRR13608004
127AATAAATCTGTCTCTTATAC-TGTGTATAAGAGACAGACAT521514637SRR13608004
128AATACGGACTTCGGCTACAC-AGAAGATACAAAGCCAAAGA114362718SRR13608004
128AATACGGACTTCGGCTACAC-AGAAGATACAAAGCCAAAGA42979088SRR13608004
128AATACGGACTTCGGCTACAC-AGAAGATACAAAGCCAAAGA511822008SRR13608004
129AATACTCGACTGCACAGTCT-TCGAGTAACAAACAGAAAAT113712215SRR21814488
129AATACTCGACTGCACAGTCT-TCGAGTAACAAACAGAAAAT25123689SRR13608004
130AATACTTAGGCTTTTAATAT-GGCTTTGTGTCTTCTAACAA43955010SRR21814492
130AATACTTAGGCTTTTAATAT-GGCTTTGTGTCTTCTAACAA512054187SRR13608004
131AATATGACTTGATATCATGT-AAGAAGATTGGTTAGTGTTT313589009SRR21814488
131AATATGACTTGATATCATGT-AAGAAGATTGGTTAGTGTTT511827816SRR13608004
132AATATTCGACTCCAAAACAC-AAATCATACACATGACATCA43973117SRR13608004
132AATATTCGACTCCAAAACAC-AAATCATACACATGACATCA44000096SRR13608004
132AATATTCGACTCCAAAACAC-AAATCATACACATGACATCA511661090SRR13608004
133AATATTTTTTCTAATAACAT-ATACAATAAGCAATTACTTT110598194SRR13608004
133AATATTTTTTCTAATAACAT-ATACAATAAGCAATTACTTT22240704SRR13608004
134AATATTTTTTCTAATAACAT-CATACAATAAGCAATTACTT110598194SRR13608004
134AATATTTTTTCTAATAACAT-CATACAATAAGCAATTACTT22240704SRR13608004
135AATCCAATGCATTTGACTAA-TGTTTTTATGGTCAAAATGT44015713SRR21814490
135AATCCAATGCATTTGACTAA-TGTTTTTATGGTCAAAATGT44064052SRR21814490
136AATCGTCGACAGGGTCCGAG-TTTCAACCCCTGGTCGACCA314191850SRR13608004
136AATCGTCGACAGGGTCCGAG-TTTCAACCCCTGGTCGACCA314191912SRR13608004
137AATCTTAAAAGCCTAAGTAA-ATAAGAACTTAAACTGCAAT23606249SRR21814495
137AATCTTAAAAGCCTAAGTAA-ATAAGAACTTAAACTGCAAT43967272SRR21814495
138AATCTTAAAAGCCTAAGTAG-ATTGAGTATAAGACTTAAAC43951473SRR21814509
138AATCTTAAAAGCCTAAGTAG-ATTGAGTATAAGACTTAAAC511735157SRR13608004
139AATCTTAAAAGCCTAAGTAG-TATAAAAACTTAAACCGCAA23615630SRR21814495
139AATCTTAAAAGCCTAAGTAG-TATAAAAACTTAAACCGCAA43951295SRR13608004
139AATCTTAAAAGCCTAAGTAG-TATAAAAACTTAAACCGCAA511734090SRR13608004
140AATCTTAAAAGCCTAAGTAG-TTAAGTATAAGAACTTAAAC43978741SRR13608004
140AATCTTAAAAGCCTAAGTAG-TTAAGTATAAGAACTTAAAC511727191SRR21814487SRR21814519
141AATCTTAAAAGCCTAAGTAG-TTGAGTATAAGAACTTAAAC511710098SRR13608004
141AATCTTAAAAGCCTAAGTAG-TTGAGTATAAGAACTTAAAC511727902SRR13608004
142AATCTTAAAAGCCTAAGTAT-TATAAGAACTTAAACAGCAA115082958SRR13608004
142AATCTTAAAAGCCTAAGTAT-TATAAGAACTTAAACAGCAA313592144SRR13608004
143AATCTTATAAGCCTAAATAG-ATTAAGTATAAGAACTTAAA511727902SRR21814505
143AATCTTATAAGCCTAAATAG-ATTAAGTATAAGAACTTAAA511754483SRR21814505
144AATGAGTCTTTGGCTTTGTA-AGCTTTCATAGTGTAGCCAA114363948SRR21814519
144AATGAGTCTTTGGCTTTGTA-AGCTTTCATAGTGTAGCCAA43951236SRR21814519
145AATGATATGATACAATGAGC-AATGTGCAAAATAAGCTAAA113917263SRR13608004
145AATGATATGATACAATGAGC-AATGTGCAAAATAAGCTAAA114216343SRR21814511
146AATGGCATTCCTTGTAAATA-ATTTATTAATAATAATTAAT21955545SRR21814507
146AATGGCATTCCTTGTAAATA-ATTTATTAATAATAATTAAT513977127SRR21814507
147AATGTCATGTGTATGATTGA-AATGTTTTGGAGTCAAATAT115148875SRR21814505
147AATGTCATGTGTATGATTGA-AATGTTTTGGAGTCAAATAT511729815SRR21814505
148AATGTGTATGATTGAGTATA-TTTGGAGTCAAATATTACTT511726440SRR13608004
148AATGTGTATGATTGAGTATA-TTTGGAGTCAAATATTACTT512026168SRR13608004
149AATTAGTCAAATGCATTGGA-ACTAATCCATCTCTAACTCT114669844SRR21814495
149AATTAGTCAAATGCATTGGA-ACTAATCCATCTCTAACTCT114952988SRR21814495
150AATTATAAGAGTTAAAGATG-TGTGTCACAATCTAATGCAT114745191SRR21814516
150AATTATAAGAGTTAAAGATG-TGTGTCACAATCTAATGCAT44067206SRR21814516
151AATTCTTATACTCAATCATA-TTTTAAGATCCGGTTGCGGT114487142SRR21814505
151AATTCTTATACTCAATCATA-TTTTAAGATCCGGTTGCGGT511823236SRR21814505
152AATTCTTATGAGTTTTTGGT-AAAGCTTTGATGGTGAACCC115090352SRR21814515
152AATTCTTATGAGTTTTTGGT-AAAGCTTTGATGGTGAACCC115091713SRR21814515
152AATTCTTATGAGTTTTTGGT-AAAGCTTTGATGGTGAACCC115310397SRR21814515
153AATTGGTTTGATGAGTAAAA-GTTGATGAGTCAAATGAGTT127859814SRR21814512
153AATTGGTTTGATGAGTAAAA-GTTGATGAGTCAAATGAGTT316354297SRR21814512
154AATTGTATCCTTGTTAAAAG-AAACCGCAACCCGATCTTAA115082088SRR21814512
154AATTGTATCCTTGTTAAAAG-AAACCGCAACCCGATCTTAA43951100SRR21814512
155AATTGTATCCTTGTTAAAAG-AAACCGCAATCGGATCTTAA115082088SRR21814506
155AATTGTATCCTTGTTAAAAG-AAACCGCAATCGGATCTTAA512063604SRR21814506
156AATTTGAGCCCAGACATTTC-AATGCCTATTGCTTTCTGAT113653070SRR21814507
156AATTTGAGCCCAGACATTTC-AATGCCTATTGCTTTCTGAT23739769SRR21814507
157AATTTTAAAAGGGTTTTAAA-AGGGTTTAAAAGATTTACAA110528418SRR13608004
157AATTTTAAAAGGGTTTTAAA-AGGGTTTAAAAGATTTACAA111983373SRR21814496
158AATTTTAAACCCTTTAAAAA-ATATTTTAAAACCCTTTTAA110528185SRR21814515
158AATTTTAAACCCTTTAAAAA-ATATTTTAAAACCCTTTTAA118301628SRR21814515
159AATTTTCCCGCCAAAAACGT-GATTTTTCCGCCAAAAACGT39322262SRR21814516
159AATTTTCCCGCCAAAAACGT-GATTTTTCCGCCAAAAACGT319428719SRR13608004
160AATTTTCCCGCCAAAAACGT-TTTTTCCGCCAAAAACGTAA39322262SRR21814496
160AATTTTCCCGCCAAAAACGT-TTTTTCCGCCAAAAACGTAA319428719SRR13608004
160AATTTTCCCGCCAAAAACGT-TTTTTCCGCCAAAAACGTAA5744742SRR21814509
161ACAAAGAAACACTACTTAGG-AGTCTTTGTCTTTGTATCTT23718228SRR13608004
161ACAAAGAAACACTACTTAGG-AGTCTTTGTCTTTGTATCTT23719796SRR13608004
162ACAAATCCTCGACCACTCCT-CTCGACCACTCCTCGGCCTG21102SRR21814506
162ACAAATCCTCGACCACTCCT-CTCGACCACTCCTCGGCCTG21134SRR21814506
163ACAACAACAACAACAAGAAG-CAACAACAACAACAACAACA39281154SRR21814495
163ACAACAACAACAACAAGAAG-CAACAACAACAACAACAACA521881254SRR21814495
164ACAACATGAAAGCTTTGAGA-AAAGACTCATACGGACTTTT23615176SRR13608004
164ACAACATGAAAGCTTTGAGA-AAAGACTCATACGGACTTTT23616589SRR21814494
165ACAACTGGGTGGTCGAGTAT-TCGACTGCACAGTCTGTTAC114228050SRR21814502
165ACAACTGGGTGGTCGAGTAT-TCGACTGCACAGTCTGTTAC314545978SRR21814502
166ACAAGAAGAAGCTTGGTTAG-CTAAACCAACAAAGCTTTGA43029123SRR13608004
166ACAAGAAGAAGCTTGGTTAG-CTAAACCAACAAAGCTTTGA512027714SRR13608004
167ACAAGTCATATTTGACTCCA-ATACACAATCATACACATGA114487171SRR13608004
167ACAAGTCATATTTGACTCCA-ATACACAATCATACACATGA43969551SRR13608004
168ACAATAAAAGCTTTGAGAAG-CAAAGACTAATATGGACTTT43952113SRR13608004
168ACAATAAAAGCTTTGAGAAG-CAAAGACTAATATGGACTTT511730998SRR13608004
169ACAATCTAATGCATTTGACT-TGTTTCTATGGTTAAAATGT114936534SRR21814505
169ACAATCTAATGCATTTGACT-TGTTTCTATGGTTAAAATGT114973304SRR21814505
170ACAATTAAAATCAACAAATT-CATTATTAATTTCCAAAAAA18115062SRR21814518
170ACAATTAAAATCAACAAATT-CATTATTAATTTCCAAAAAA112329762SRR21814518
171ACAATTTATTTTTTAAATTA-TTAACCCGCGGTACACCGCG14770145SRR13608004
171ACAATTTATTTTTTAAATTA-TTAACCCGCGGTACACCGCG46426647SRR21814511
172ACACAAAGCCAAAGAATCAT-CCTAAGTAGTGTTTCCTTGT42958005SRR13608004
172ACACAAAGCCAAAGAATCAT-CCTAAGTAGTGTTTCCTTGT511827016SRR21814497
173ACACAAAGCCAAAGACTCAT-AAGTAGTGTTTTCTTGTTAG511796336SRR21814501
173ACACAAAGCCAAAGACTCAT-AAGTAGTGTTTTCTTGTTAG512048345SRR13608004
174ACACACACACACACACACAC-CTCACACACACACACACACA126645137SRR21814497
174ACACACACACACACACACAC-CTCACACACACACACACACA514739587SRR21814497
175ACACACACACACACACACAT-CAAACACACACACACACACA11148539SRR21814503
175ACACACACACACACACACAT-CAAACACACACACACACACA55705057SRR21814503
176ACACCATGAAAGCTTTGAGA-AAAGTCCATATGAGTCTTTG23604258SRR13608004
176ACACCATGAAAGCTTTGAGA-AAAGTCCATATGAGTCTTTG511683053SRR13608004
177ACACTAAACAATATAGATAA-TTATCTATATTGTTTAGTGT520681624SRR21814507
177ACACTAAACAATATAGATAA-TTATCTATATTGTTTAGTGT520681633SRR21814507
178ACACTACTTAGGCTTTTAAG-GTCTTTGGCTTTGTGTCTTC23719982SRR21814507
178ACACTACTTAGGCTTTTAAG-GTCTTTGGCTTTGTGTCTTC511753973SRR13608004
178ACACTACTTAGGCTTTTAAG-GTCTTTGGCTTTGTGTCTTC512058455SRR13608004
179ACAGAAGATGTCTCAGAAGC-GCTTGACATACCTATTGAGT113518632SRR21814502
179ACAGAAGATGTCTCAGAAGC-GCTTGACATACCTATTGAGT22377504SRR13608004
180ACAGCAACCCGATCTTAAAA-ACGATTGAGTATAAGAACTT313591422SRR13608004
180ACAGCAACCCGATCTTAAAA-ACGATTGAGTATAAGAACTT43955755SRR13608004
181ACATAAAGTCATATTCGACT-GGTCTTATACTCAATCATAC114544093SRR13608004
181ACATAAAGTCATATTCGACT-GGTCTTATACTCAATCATAC511727687SRR13608004
182ACATATTCGACTCCAAAACA-TACGCAATCATACACATGAC114544810SRR13608004
182ACATATTCGACTCCAAAACA-TACGCAATCATACACATGAC511729813SRR13608004
183ACATCTCGGTATTTCGTGCG-CACGAAATACCGAGATGTCC22315SRR13608004
183ACATCTCGGTATTTCGTGCG-CACGAAATACCGAGATGTCC22322SRR13608004
184ACATCTCGGTATTTCGTGCG-CGCACGAAATACCGAGATGT22315SRR13608004
184ACATCTCGGTATTTCGTGCG-CGCACGAAATACCGAGATGT22322SRR13608004
185ACATGACATCAAGTCATAAG-CTAGTTCTTATACTCAATCA43951150SRR21814509
185ACATGACATCAAGTCATAAG-CTAGTTCTTATACTCAATCA511702715SRR21814509
186ACATGACATCAAGTCATATT-TGCGGTTTAAGTTCTTATAC23602553SRR13608004
186ACATGACATCAAGTCATATT-TGCGGTTTAAGTTCTTATAC43038806SRR13608004
186ACATGACATCAAGTCATATT-TGCGGTTTAAGTTCTTATAC511737617SRR13608004
186ACATGACATCAAGTCATATT-TGCGGTTTAAGTTCTTATAC512028652SRR13608004
187ACATTACATCTAGTCATATT-TCTAGTTCTTATACTCAATC23615775SRR21814492
187ACATTACATCTAGTCATATT-TCTAGTTCTTATACTCAATC43039339SRR13608004
188ACCAACCTTCTTCTTGCTTC-GAAGCAAGAAGAAGGTTGGT28336SRR21814500
188ACCAACCTTCTTCTTGCTTC-GAAGCAAGAAGAAGGTTGGT28341SRR21814500
189ACCAACCTTCTTCTTGCTTC-TAATATTCGACTCCAAAACA43045804SRR13608004
189ACCAACCTTCTTCTTGCTTC-TAATATTCGACTCCAAAACA43967163SRR13608004
190ACCACCACCTGGGTTTGCAA-GCAATTTCAGGGGAACTACC43383420SRR21814511
190ACCACCACCTGGGTTTGCAA-GCAATTTCAGGGGAACTACC511805106SRR21814511
191ACCACTCCTCGGACACGGTC-ACTCCTGGTCGACAAATCCT21134SRR13608004
191ACCACTCCTCGGACACGGTC-ACTCCTGGTCGACAAATCCT21452SRR13608004
191ACCACTCCTCGGACACGGTC-ACTCCTGGTCGACAAATCCT314192011SRR21814515
192ACCATCAAAGCTTTGAGAAA-AAGCCAAAGACTCATACGGA115149236SRR21814493
192ACCATCAAAGCTTTGAGAAA-AAGCCAAAGACTCATACGGA43046375SRR21814493
193ACCCTCGACCAGGACGATGA-CCATTCATCGTCCTGGTCGA21116SRR13608004
193ACCCTCGACCAGGACGATGA-CCATTCATCGTCCTGGTCGA314191792SRR13608004
194ACCGCAACCAGATCTTAAAA-CTATGATTGAGTATAAGAAC115082240SRR21814486
194ACCGCAACCAGATCTTAAAA-CTATGATTGAGTATAAGAAC115437587SRR21814486
195ACCTTCTTCTTGCTTCTCAA-CATATTCGACACCAAAACAC114484779SRR21814497
195ACCTTCTTCTTGCTTCTCAA-CATATTCGACACCAAAACAC511705036SRR13608004
196ACGAAACTACTCAATTACCC-GAGCATGTCAATCACCTGTA113652785SRR21814512
196ACGAAACTACTCAATTACCC-GAGCATGTCAATCACCTGTA24154659SRR21814512
197ACGGACTTTGGCTACACCAT-AAGACACAAAGCCAAAGACT43196460SRR21814505
197ACGGACTTTGGCTACACCAT-AAGACACAAAGCCAAAGACT43968105SRR13608004
198ACTAACCAACCTTCTTCTTG-GACATCTAGTAATATTTGAC42920412SRR13608004
198ACTAACCAACCTTCTTCTTG-GACATCTAGTAATATTTGAC511956286SRR13608004
199ACTAACCAAGCTTCTTCTTG-CAAGTCATATTCGACTCCAA114509016SRR21814518
199ACTAACCAAGCTTCTTCTTG-CAAGTCATATTCGACTCCAA115599626SRR13608004
200ACTAATTATAAGAGTTAAAG-AGTCAAAATGTGTTACAATC114686170SRR21814518
200ACTAATTATAAGAGTTAAAG-AGTCAAAATGTGTTACAATC114721858SRR21814518
201ACTAGCTACGTGGAGGCATC-ACGAACGAGACCTCAGCCTG25054SRR21814500
201ACTAGCTACGTGGAGGCATC-ACGAACGAGACCTCAGCCTG25056SRR13608004
202ACTAGGGGTGTCAAAATGGG-CCCATTTTGACACCCCTAGT316489840SRR21814512
202ACTAGGGGTGTCAAAATGGG-CCCATTTTGACACCCCTAGT316489843SRR21814512
203ACTCATACAGACTTTGGCTA-CATTGTTAGAAGATACAAAG114544180SRR13608004
203ACTCATACAGACTTTGGCTA-CATTGTTAGAAGATACAAAG43041355SRR13608004
203ACTCATACAGACTTTGGCTA-CATTGTTAGAAGATACAAAG511758265SRR13608004
204ACTCATATGGACTTTGGCTA-TTCCTTGTTAGAAGACACAA43041711SRR13608004
204ACTCATATGGACTTTGGCTA-TTCCTTGTTAGAAGACACAA43952669SRR13608004
205ACTCCAAAACACTAACAAAA-ATACACATGACATCAAGTCA42923096SRR13608004
205ACTCCAAAACACTAACAAAA-ATACACATGACATCAAGTCA511733325SRR21814492
206ACTCCCATCAAAAGATGGTT-ACCCTTGGCCGGCTATCGAA23030SRR21814506
206ACTCCCATCAAAAGATGGTT-ACCCTTGGCCGGCTATCGAA23046SRR13608004
207ACTCTTTTGGGAGAAAATGG-CCATTTTCTCCCAAAAGAGT114934063SRR13608004
207ACTCTTTTGGGAGAAAATGG-CCATTTTCTCCCAAAAGAGT114934067SRR13608004
208ACTGGTTGGTAGCTTGGAGG-CCTCCAAGCTACCAACCAGT119936304SRR13608004
208ACTGGTTGGTAGCTTGGAGG-CCTCCAAGCTACCAACCAGT119936313SRR13608004
209ACTGTAACGCCCGCGATCCT-GTCCGGATCGGGGCCTTTCA23144SRR21814513
209ACTGTAACGCCCGCGATCCT-GTCCGGATCGGGGCCTTTCA22717327SRR21814513
210ACTGTGGATGTCGGATTCGG-TGCGGATTCCGACATCCACA34875522SRR21814506
210ACTGTGGATGTCGGATTCGG-TGCGGATTCCGACATCCACA323130755SRR21814506
210ACTGTGGATGTCGGATTCGG-TGCGGATTCCGACATCCACA46008626SRR21814506
211ACTTAAGCTTTTAGGATAAG-TGTGTCTTCTAACAAGGAAA44001632SRR21814505
211ACTTAAGCTTTTAGGATAAG-TGTGTCTTCTAACAAGGAAA44003768SRR21814505
212ACTTAAGGATCGAATTCCAC-TACTCTCTCAAATAAGAGAT115428526SRR21814505
212ACTTAAGGATCGAATTCCAC-TACTCTCTCAAATAAGAGAT312755871SRR21814505
213ACTTAAGGGTCGAATTCCAC-CACTCTCTCAAATAAGAGAT114079935SRR21814498
213ACTTAAGGGTCGAATTCCAC-CACTCTCTCAAATAAGAGAT117407931SRR21814488SRR21814491SRR21814496SRR21814498SRR21814499SRR21814504SRR21814516SRR21814518SRR21814519
213ACTTAAGGGTCGAATTCCAC-CACTCTCTCAAATAAGAGAT23740765SRR21814519
213ACTTAAGGGTCGAATTCCAC-CACTCTCTCAAATAAGAGAT511288949SRR21814488SRR21814491SRR21814496SRR21814499SRR21814504SRR21814516SRR21814518
214ACTTAGGCTTATAAGATCGG-GCTTTGTGTCTTCTAACAAG511668744SRR13608004
214ACTTAGGCTTATAAGATCGG-GCTTTGTGTCTTCTAACAAG511894383SRR13608004
214ACTTAGGCTTATAAGATCGG-GCTTTGTGTCTTCTAACAAG511965283SRR13608004
215ACTTCTCAAAGCTTTCATGG-AAACACTAACAAAGCTTCTT114544315SRR13608004
215ACTTCTCAAAGCTTTCATGG-AAACACTAACAAAGCTTCTT23605977SRR13608004
216ACTTGGATTAACAAGAGTGG-TGCTCTAATAAGGAGAGTAA113775383SRR13608004
216ACTTGGATTAACAAGAGTGG-TGCTCTAATAAGGAGAGTAA43347578SRR21814507
217ACTTTAGCAAATAAATCCTC-AATCTACATATACATTTTTG113480090SRR21814503
217ACTTTAGCAAATAAATCCTC-AATCTACATATACATTTTTG113869896SRR21814503
218ACTTTAGCTTCCGGAATCCA-CCCAAACTTTAAAACCTAAA115170810SRR13608004
218ACTTTAGCTTCCGGAATCCA-CCCAAACTTTAAAACCTAAA115290947SRR21814503
219ACTTTGGCTAAACCATCAAA-TACAAAGCCAAAGACTCATA44000166SRR21814487
219ACTTTGGCTAAACCATCAAA-TACAAAGCCAAAGACTCATA512045787SRR13608004
220ACTTTGGCTACACCATGAAA-ACACATGAGATCAAGTCATA210081SRR21814497
220ACTTTGGCTACACCATGAAA-ACACATGAGATCAAGTCATA210401SRR21814497
221AGAAAAAGGTTGGTTAGTGT-CACCATGAAAGCTTGGAAAA115084820SRR13608004
221AGAAAAAGGTTGGTTAGTGT-CACCATGAAAGCTTGGAAAA23605977SRR13608004
222AGAAAATTACGGGTTTACGT-AATCACGGGTTTACGTTTTT110526696SRR21814494
222AGAAAATTACGGGTTTACGT-AATCACGGGTTTACGTTTTT125098676SRR13608004
223AGAAACACTAACAAAGCTAT-ATTGGATTGTGACACATTTT114935597SRR21814505
223AGAAACACTAACAAAGCTAT-ATTGGATTGTGACACATTTT115037893SRR21814505
224AGAAAGCTTTGAGAAGCAAG-AATATGGACTTTGGCTACAC23615360SRR13608004
224AGAAAGCTTTGAGAAGCAAG-AATATGGACTTTGGCTACAC313590084SRR13608004
225AGAAAGTTTTGTTGGTTTTA-AACACTAACAAATATATTGA114933412SRR13608004
225AGAAAGTTTTGTTGGTTTTA-AACACTAACAAATATATTGA114972717SRR13608004
226AGAAGAAGAAGAAGAAGAAG-GATCTAGAAGAAGAAGAAGA19090161SRR21814503
226AGAAGAAGAAGAAGAAGAAG-GATCTAGAAGAAGAAGAAGA219026961SRR21814503
227AGAAGAGAGGTCGAGTATCA-CGACAGCGGTGCTGGCCGCA114254425SRR13608004
227AGAAGAGAGGTCGAGTATCA-CGACAGCGGTGCTGGCCGCA511469740SRR21814490
228AGAAGCTTGGTTAGTGTTTT-CACAATCAAAGCTTTGAGAA115437694SRR13608004
228AGAAGCTTGGTTAGTGTTTT-CACAATCAAAGCTTTGAGAA511958509SRR13608004
229AGAAGCTTGGTTAGTGTTTT-CATTAAAGCTTTGAGAAGCA115437694SRR13608004
229AGAAGCTTGGTTAGTGTTTT-CATTAAAGCTTTGAGAAGCA115690572SRR13608004
229AGAAGCTTGGTTAGTGTTTT-CATTAAAGCTTTGAGAAGCA23660838SRR13608004
230AGAATCCCTAAACCCAACAA-CTAATCCATCTAAATCCATA114327075SRR13608004
230AGAATCCCTAAACCCAACAA-CTAATCCATCTAAATCCATA23982723SRR13608004
231AGACATTTCAATGTATGTTG-TTTCTTTTTTTTTGGCACCG21808SRR13608004
231AGACATTTCAATGTATGTTG-TTTCTTTTTTTTTGGCACCG314194195SRR21814493
232AGACCAAGCCCTTTACACGT-TTTTACGTGTAAAGGGCTTG114325041SRR13608004
232AGACCAAGCCCTTTACACGT-TTTTACGTGTAAAGGGCTTG114325046SRR13608004
233AGACTCCAAAACACTAACCA-ACACATTACATCAAGTCATA23663125SRR13608004
233AGACTCCAAAACACTAACCA-ACACATTACATCAAGTCATA43966791SRR13608004
234AGAGAGAGAGAAAGAGAGAG-GAGAGAGAGAAAGAGAGAGA318155334SRR21814486
234AGAGAGAGAGAAAGAGAGAG-GAGAGAGAGAAAGAGAGAGA41290104SRR21814486
235AGAGCACTCTATAGATGATC-GATCATCTATAGAGTGCTCT114086949SRR13608004
235AGAGCACTCTATAGATGATC-GATCATCTATAGAGTGCTCT114086958SRR13608004
236AGAGCGCTTCTAATAACGTT-AACGTTATTAGAAGCGCTCT110604901SRR13608004
236AGAGCGCTTCTAATAACGTT-AACGTTATTAGAAGCGCTCT110604909SRR13608004
237AGAGGGAGAACCAATCAAGC-CGCAAACGCAGCGTTTGCGG113242236SRR13608004
237AGAGGGAGAACCAATCAAGC-CGCAAACGCAGCGTTTGCGG212810769SRR13608004
238AGAGTTTAGGGTTTAGGGTT-TTAAGGGTTTAGGGTTAAGA115148607SRR21814486
238AGAGTTTAGGGTTTAGGGTT-TTAAGGGTTTAGGGTTAAGA115421608SRR21814486
239AGATATCCGGATTCACTCAG-TTCTGAGTGAATCCGGATAT115458042SRR13608004
239AGATATCCGGATTCACTCAG-TTCTGAGTGAATCCGGATAT115458049SRR13608004
240AGATCAAGTCATATTCGACT-GTTCTTATGCTCAATCATAC43034348SRR21814492
240AGATCAAGTCATATTCGACT-GTTCTTATGCTCAATCATAC43965673SRR21814492
241AGATCGGGTTGCGGTTTAAG-ACAAGGATACAATTCTTACG117490793SRR21814512
241AGATCGGGTTGCGGTTTAAG-ACAAGGATACAATTCTTACG511959250SRR13608004
242AGATGTCATGTGTATGAGTG-TGGTTAGTGTTTTGGAGTCG511852405SRR21814505
242AGATGTCATGTGTATGAGTG-TGGTTAGTGTTTTGGAGTCG512062475SRR21814505
243AGATTTTTCCGCCAAAAACG-TTTTTCCGCCAAAAACGTAA5744741SRR21814497
243AGATTTTTCCGCCAAAAACG-TTTTTCCGCCAAAAACGTAA524819779SRR21814497
244AGCGCCCACCTAGTCCTATC-TCTTTTAAACACATCCCAAC23638994SRR13608004
244AGCGCCCACCTAGTCCTATC-TCTTTTAAACACATCCCAAC44434170SRR21814517
245AGCGTAGTCGAGCAAGGATA-TATCCTTGCTCGACTACGCT23078172SRR13608004
245AGCGTAGTCGAGCAAGGATA-TATCCTTGCTCGACTACGCT23078180SRR13608004
246AGCGTCTCCCCAAGCTTTCT-AGAAAGCTTGGGGAGACGCT29838SRR21814510
246AGCGTCTCCCCAAGCTTTCT-AGAAAGCTTGGGGAGACGCT29846SRR21814510
247AGCGTTCATGGTGTAGCCAA-AAACCTTCTTCTAGCTTCTC115082157SRR13608004
247AGCGTTCATGGTGTAGCCAA-AAACCTTCTTCTAGCTTCTC511728698SRR13608004
248AGCTTAAAAGCCTAAGTAGT-ATAAGAACTTAAACAGCAAC23618534SRR13608004
248AGCTTAAAAGCCTAAGTAGT-ATAAGAACTTAAACAGCAAC43969509SRR13608004
249AGCTTCTCAAAGCTTTCATA-AAACAATAACCAAGCTTCTT114544314SRR13608004
249AGCTTCTCAAAGCTTTCATA-AAACAATAACCAAGCTTCTT23660840SRR21814519
250AGCTTTGATGGTGTAGCAGA-CACTAACCAAGCTTCTTCTT115113257SRR21814517
250AGCTTTGATGGTGTAGCAGA-CACTAACCAAGCTTCTTCTT512054784SRR21814517
251AGGAAAAGATCGGAAGAGCG-GAGTCTTTGGCTTTGTATCT43012455SRR21814493
251AGGAAAAGATCGGAAGAGCG-GAGTCTTTGGCTTTGTATCT43968667SRR21814493
252AGGAAAGTCCTCGTGTTGCA-GAGTACTAGGATGGGTGACC313810158SRR13608004
252AGGAAAGTCCTCGTGTTGCA-GAGTACTAGGATGGGTGACC511312050SRR13608004
253AGGATAAAACCAACAAAAAA-TTATACCCATTTTCTCCTAA114603140SRR21814486
253AGGATAAAACCAACAAAAAA-TTATACCCATTTTCTCCTAA114609511SRR21814486
253AGGATAAAACCAACAAAAAA-TTATACCCATTTTCTCCTAA44014363SRR21814486
253AGGATAAAACCAACAAAAAA-TTATACCCATTTTCTCCTAA44066508SRR21814486
254AGGATTTATTTCACAAAATG-TGGCAACCATTGTAAATAAG123125650SRR13608004
254AGGATTTATTTCACAAAATG-TGGCAACCATTGTAAATAAG319520684SRR21814520
255AGGATTTTTAGTAATTAAAC-GTTTTATTACTAAAAACCCT22139704SRR21814504SRR21814513
255AGGATTTTTAGTAATTAAAC-GTTTTATTACTAAAAACCCT213621896SRR21814504SRR21814513
256AGGCCCTGTTTGTTTCATCA-ATGGACAAACAAACAGGGCC121098501SRR21814500
256AGGCCCTGTTTGTTTCATCA-ATGGACAAACAAACAGGGCC414643619SRR21814500
256AGGCCCTGTTTGTTTCATCA-ATGGACAAACAAACAGGGCC58045612SRR21814500
257AGGCCTGGGGGTTCGGTTAT-CTTCCGAACTCCCAGGCCTA5218157SRR21814504
257AGGCCTGGGGGTTCGGTTAT-CTTCCGAACTCCCAGGCCTA513252851SRR21814504
258AGGCTTATAAGATCGGGTTG-CATCTTCTAACAAGGAAACA114510858SRR21814516
258AGGCTTATAAGATCGGGTTG-CATCTTCTAACAAGGAAACA114545636SRR21814516
259AGGCTTTTAAGATCGGGTTG-CTTCTAACAAGAAAACACTA114510535SRR21814497
259AGGCTTTTAAGATCGGGTTG-CTTCTAACAAGAAAACACTA43025989SRR21814497
260AGGGAAATTTACTAGAGTAA-TCAATCTAAGCAAATCTTAC116791045SRR21814498
260AGGGAAATTTACTAGAGTAA-TCAATCTAAGCAAATCTTAC520175029SRR21814498
261AGGGAATTTAATGAAAAAAA-GTTTTTTTCATTAAATTCCC112255984SRR21814492
261AGGGAATTTAATGAAAAAAA-GTTTTTTTCATTAAATTCCC112255990SRR21814492
261AGGGAATTTAATGAAAAAAA-GTTTTTTTCATTAAATTCCC123802708SRR21814492
262AGGGAATTTAATGAAAAAAA-TTTTTTTCATTAAATTCCCA128424481SRR21814488
262AGGGAATTTAATGAAAAAAA-TTTTTTTCATTAAATTCCCA210580842SRR21814488
262AGGGAATTTAATGAAAAAAA-TTTTTTTCATTAAATTCCCA510370818SRR21814488
263AGGGAATTTAATGAAAAAAA-TTTTTTTCATTAAATTCCCT124289451SRR21814491
263AGGGAATTTAATGAAAAAAA-TTTTTTTCATTAAATTCCCT41533310SRR21814504
263AGGGAATTTAATGAAAAAAA-TTTTTTTCATTAAATTCCCT41533316SRR21814504
263AGGGAATTTAATGAAAAAAA-TTTTTTTCATTAAATTCCCT58320646SRR21814487SRR21814503
263AGGGAATTTAATGAAAAAAA-TTTTTTTCATTAAATTCCCT58320652SRR21814487SRR21814503
263AGGGAATTTAATGAAAAAAA-TTTTTTTCATTAAATTCCCT58676721SRR21814487SRR21814503SRR21814508SRR21814510SRR21814511
263AGGGAATTTAATGAAAAAAA-TTTTTTTCATTAAATTCCCT58676727SRR21814487SRR21814503SRR21814508SRR21814510SRR21814511
263AGGGAATTTAATGAAAAAAA-TTTTTTTCATTAAATTCCCT526746314SRR21814487SRR21814490SRR21814491SRR21814504SRR21814505SRR21814510SRR21814511
263AGGGAATTTAATGAAAAAAA-TTTTTTTCATTAAATTCCCT526746320SRR21814487SRR21814490SRR21814491SRR21814504SRR21814505SRR21814510SRR21814511
264AGGGTGAATTGGTATTTGAA-ACACGTGAAAGTGGTTTTTT114231869SRR21814503
264AGGGTGAATTGGTATTTGAA-ACACGTGAAAGTGGTTTTTT511911671SRR21814503
265AGGGTTTTTAGTAATAAAAC-GGTTTAATTACTAAAAATCC213621902SRR21814517
265AGGGTTTTTAGTAATAAAAC-GGTTTAATTACTAAAAATCC36356218SRR21814517
266AGGTAAAGAAAATGCATAGT-ACTATGCATTTTCTTTACCT121450307SRR13608004
266AGGTAAAGAAAATGCATAGT-ACTATGCATTTTCTTTACCT121450308SRR13608004
267AGTAATATTCGACTCCAAAA-ACCCAATCATACACATGACA115084860SRR13608004
267AGTAATATTCGACTCCAAAA-ACCCAATCATACACATGACA44000983SRR13608004
267AGTAATATTCGACTCCAAAA-ACCCAATCATACACATGACA511729103SRR13608004
268AGTAATATTCGACTCCAAAA-GATACTCAATCATACACATG43976829SRR13608004
268AGTAATATTCGACTCCAAAA-GATACTCAATCATACACATG44000983SRR13608004
269AGTAATATTCGACTCCAAAA-TTATACCCAATCATACACAT44000983SRR13608004
269AGTAATATTCGACTCCAAAA-TTATACCCAATCATACACAT511790052SRR13608004
270AGTAGAATATGACTTGATGT-AAGAAGGGTGGTTAGTGTTT511732468SRR13608004
270AGTAGAATATGACTTGATGT-AAGAAGGGTGGTTAGTGTTT511736701SRR13608004
271AGTAGCCAAAGTCCATATGA-ATTCTTGCTTCTCAAAGCTT313670319SRR13608004
271AGTAGCCAAAGTCCATATGA-ATTCTTGCTTCTCAAAGCTT511726909SRR13608004
272AGTATAGAACAAAGGCAGAT-AGTAAAGAACTTAACAAGAT113737263SRR13608004
272AGTATAGAACAAAGGCAGAT-AGTAAAGAACTTAACAAGAT22718213SRR13608004
273AGTATAGAACAAAGGCAGAT-CAGTAAAGAACTTAACAAGA113737263SRR13608004
273AGTATAGAACAAAGGCAGAT-CAGTAAAGAACTTAACAAGA22718213SRR13608004
274AGTATGAAGTGCTACTCGAA-AGGGGAAGGTTTAAAAAACC22930SRR21814496
274AGTATGAAGTGCTACTCGAA-AGGGGAAGGTTTAAAAAACC22937SRR13608004
275AGTCCATATGAGTCTTTGTC-CAAAGCTTTCATGGTGTAGC43966851SRR13608004
275AGTCCATATGAGTCTTTGTC-CAAAGCTTTCATGGTGTAGC512062762SRR13608004
276AGTCCATATTAGTCTTTGGC-CAAAGCTTTCATGGTGTAGC43026574SRR21814511
276AGTCCATATTAGTCTTTGGC-CAAAGCTTTCATGGTGTAGC511730991SRR13608004
277AGTCCGTATGAGTCTTTGGC-TCTCAAAGCTTTGATGGTTA115090352SRR13608004
277AGTCCGTATGAGTCTTTGGC-TCTCAAAGCTTTGATGGTTA43045492SRR21814493
278AGTCGAATATGACTTGATCT-AAGCAAGAAGAAGGTTGGTT115083428SRR21814495
278AGTCGAATATGACTTGATCT-AAGCAAGAAGAAGGTTGGTT43012906SRR13608004
279AGTCTTTGGCTTTGTGTCTT-TAATGGTGTAGCCAAAGTCC115748007SRR13608004
279AGTCTTTGGCTTTGTGTCTT-TAATGGTGTAGCCAAAGTCC23661594SRR13608004
280AGTTAGAGATGGATTAGAAG-CCAATGCAATTGACTAATTA114888132SRR21814497
280AGTTAGAGATGGATTAGAAG-CCAATGCAATTGACTAATTA115010663SRR21814497
281AGTTGAGACTTATTTACAAT-CCATTTTGTGAAATAAATCC118450352SRR21814493
281AGTTGAGACTTATTTACAAT-CCATTTTGTGAAATAAATCC47652608SRR21814493
282AGTTGATCAAAAAGCAATAG-GAAATGTTTGGGCTCAAATT114059853SRR21814500
282AGTTGATCAAAAAGCAATAG-GAAATGTTTGGGCTCAAATT313426432SRR21814500
283AGTTGCGGTTTAAGTTCTTA-AAAGAAACACTACTTAGGCT23663783SRR13608004
283AGTTGCGGTTTAAGTTCTTA-AAAGAAACACTACTTAGGCT43969688SRR21814489
284AGTTGCGGTTTAAGTTCTTA-AATACTTACGCCTTTAAGAT23605893SRR13608004
284AGTTGCGGTTTAAGTTCTTA-AATACTTACGCCTTTAAGAT23606427SRR13608004
285AGTTGCGGTTTAAGTTCTTA-CACTACTTAGGCTTATAAGA43977497SRR21814517
285AGTTGCGGTTTAAGTTCTTA-CACTACTTAGGCTTATAAGA511668763SRR21814517
286AGTTGTCAATCCAAATGGGT-AATCATATCGTTGTAGTACT113644612SRR21814489SRR21814507
286AGTTGTCAATCCAAATGGGT-AATCATATCGTTGTAGTACT113712441SRR13608004
287AGTTGTGGTTTAAGTTCTTA-AAACACTACTTAAGCTTTTA23627610SRR21814486
287AGTTGTGGTTTAAGTTCTTA-AAACACTACTTAAGCTTTTA313590186SRR21814486
288AGTTTAAGTTCTTATACTAA-AAGGCTTTTAAGATCGGGTT23663078SRR13608004
288AGTTTAAGTTCTTATACTAA-AAGGCTTTTAAGATCGGGTT511705325SRR13608004
289AGTTTAAGTTCTTATACTAA-TAAGGCTTTTAAGATCGGGT23663078SRR13608004
289AGTTTAAGTTCTTATACTAA-TAAGGCTTTTAAGATCGGGT511705325SRR13608004
290AGTTTAAGTTCTTATACTCA-ATTCTTACGCCTTTAAGATC43975724SRR13608004
290AGTTTAAGTTCTTATACTCA-ATTCTTACGCCTTTAAGATC511727185SRR21814487
291AGTTTAAGTTCTTATACTCA-TACGCCTTTAAGATCCGGTT313587161SRR13608004
291AGTTTAAGTTCTTATACTCA-TACGCCTTTAAGATCCGGTT43975724SRR13608004
292AGTTTAAGTTGTTATACTCA-ATTCTTACGCCTTTAAGATC23618527SRR21814490
292AGTTTAAGTTGTTATACTCA-ATTCTTACGCCTTTAAGATC43976613SRR13608004
293AGTTTACAGGTGATTGACAT-AATTGAGTAGTTTCGTTTTC113645186SRR21814501
293AGTTTACAGGTGATTGACAT-AATTGAGTAGTTTCGTTTTC44436322SRR21814501
294ATAAAAGCTTTGAGAAGCAA-CCAAAGACTCATACTGACTT23660682SRR13608004
294ATAAAAGCTTTGAGAAGCAA-CCAAAGACTCATACTGACTT42978397SRR13608004
295ATAAAATATGAGATTTTAGA-TAAAAAATTCTCTTGATTTT122776060SRR21814510
295ATAAAATATGAGATTTTAGA-TAAAAAATTCTCTTGATTTT125594441SRR21814510
296ATAATAAATATTAATTTATA-TATAAATTAATATTTATTAT110008133SRR21814500
296ATAATAAATATTAATTTATA-TATAAATTAATATTTATTAT110008140SRR21814500
297ATAATTAGTCAAATGCATAG-ACACTCCTAATCCATCTCTA114673006SRR21814510
297ATAATTAGTCAAATGCATAG-ACACTCCTAATCCATCTCTA44057612SRR21814510
298ATAATTAGTCAAATGCATTG-CCCCTAATCCATCTCTAACT114690295SRR13608004
298ATAATTAGTCAAATGCATTG-CCCCTAATCCATCTCTAACT114932229SRR13608004
299ATAATTTTCCCGCCAAAAAA-TTTCCCGCCAAAAACATAAA110526601SRR21814501
299ATAATTTTCCCGCCAAAAAA-TTTCCCGCCAAAAACATAAA125098469SRR21814501
300ATACAAAGCCAAAGACTCAT-AAGTAGTGTTTCCTTGTTAG511683060SRR13608004
300ATACAAAGCCAAAGACTCAT-AAGTAGTGTTTCCTTGTTAG511955499SRR13608004
301ATACACCATGAAAGCTTTGA-GCCAAAGACTCATATGGACT115083556SRR13608004
301ATACACCATGAAAGCTTTGA-GCCAAAGACTCATATGGACT42979458SRR13608004
302ATACACCCTGCCTTTTATGA-CATAAAAGGCAGGGTGTATA114313296SRR13608004
302ATACACCCTGCCTTTTATGA-CATAAAAGGCAGGGTGTATA114313305SRR13608004
303ATACCGCCACCCAAACGGCC-GGCCGTTTGGGTGGCGGTAT53253150SRR13608004
303ATACCGCCACCCAAACGGCC-GGCCGTTTGGGTGGCGGTAT53253156SRR13608004
304ATAGAATACCTGAAAAGACA-CCTTATCTCCATTGTTGTCC113293958SRR13608004
304ATAGAATACCTGAAAAGACA-CCTTATCTCCATTGTTGTCC24413721SRR13608004
304ATAGAATACCTGAAAAGACA-CCTTATCTCCATTGTTGTCC25727298SRR13608004
305ATAGGGGTGTCAAAATGGGT-ACCCATTTTGACACCCCTAA26384830SRR21814490
305ATAGGGGTGTCAAAATGGGT-ACCCATTTTGACACCCCTAA31446703SRR21814490
306ATAGGGGTGTCAAAATGGGT-ACCCATTTTGACACCCCTAT130168816SRR21814509SRR21814517
306ATAGGGGTGTCAAAATGGGT-ACCCATTTTGACACCCCTAT130168821SRR21814509SRR21814517
306ATAGGGGTGTCAAAATGGGT-ACCCATTTTGACACCCCTAT314963012SRR21814509
306ATAGGGGTGTCAAAATGGGT-ACCCATTTTGACACCCCTAT314963017SRR21814509
307ATATATATATATAATGTTAT-ATGTTATATATATATATATA111839635SRR21814507
307ATATATATATATAATGTTAT-ATGTTATATATATATATATA111839637SRR13608004
308ATATATATATATATGTATAT-TATATATATATATATGTATA119624557SRR21814500
308ATATATATATATATGTATAT-TATATATATATATATGTATA510294298SRR13608004
309ATATGCTAGTAATTTAAGTC-CTTGTCATCAACTACACAAT116712692SRR21814490
309ATATGCTAGTAATTTAAGTC-CTTGTCATCAACTACACAAT511275735SRR13608004
310ATATGTTGTTTGTTTCATTC-TTACTATGTTTATGCTTTTT113780643SRR13608004
310ATATGTTGTTTGTTTCATTC-TTACTATGTTTATGCTTTTT113780644SRR21814494
311ATATTAAAAGCCTAAGTAGT-ATAAGAACTTAAACAGCAAC43969509SRR13608004
311ATATTAAAAGCCTAAGTAGT-ATAAGAACTTAAACAGCAAC511726658SRR13608004
312ATATTAGACTCCAAAACACT-AATAATACACATGACATCAA43973118SRR13608004
312ATATTAGACTCCAAAACACT-AATAATACACATGACATCAA511729811SRR13608004
313ATATTCGACTCAAAAACACT-CTCAATCATACACATGACAT115200053SRR21814520
313ATATTCGACTCAAAAACACT-CTCAATCATACACATGACAT511794483SRR21814520
314ATATTTTTTCTAATAACATT-ATACAATAAGCAATTACTTT110598193SRR13608004
314ATATTTTTTCTAATAACATT-ATACAATAAGCAATTACTTT22240705SRR13608004
315ATCAGAAAGCAATAGGCATT-GAAATGTCTGGGCTCAAATT113653076SRR21814507
315ATCAGAAAGCAATAGGCATT-GAAATGTCTGGGCTCAAATT23739763SRR21814507
316ATCATAAAAGCCTAAGTAGT-ATTGAGTATAATAACTTAAA43970577SRR13608004
316ATCATAAAAGCCTAAGTAGT-ATTGAGTATAATAACTTAAA511733026SRR13608004
317ATCCATATGAGTCTTTGGCT-TTAAAGCTTTGATGGTGTAG43039080SRR21814500
317ATCCATATGAGTCTTTGGCT-TTAAAGCTTTGATGGTGTAG511963550SRR13608004
318ATCCTTGTTAAAAGACACAA-ATCTTAAAGGCGTAAGAATT115082272SRR21814509
318ATCCTTGTTAAAAGACACAA-ATCTTAAAGGCGTAAGAATT313589088SRR21814509
319ATCCTTGTTAGAAGACACAA-AACCCGATCTTAAAAGCCTA44005903SRR21814497
319ATCCTTGTTAGAAGACACAA-AACCCGATCTTAAAAGCCTA511822155SRR13608004
319ATCCTTGTTAGAAGACACAA-AACCCGATCTTAAAAGCCTA511958613SRR21814497
320ATCCTTGTTAGAAGACACAA-AGCTTAAAAGCCTAAGTAGT511669803SRR13608004
320ATCCTTGTTAGAAGACACAA-AGCTTAAAAGCCTAAGTAGT511704763SRR13608004
321ATCCTTGTTAGAAGACACAA-CCCGATCTTAAAAGCCTAAG44005903SRR21814519
321ATCCTTGTTAGAAGACACAA-CCCGATCTTAAAAGCCTAAG511668740SRR21814519
321ATCCTTGTTAGAAGACACAA-CCCGATCTTAAAAGCCTAAG511822155SRR13608004
322ATCGAACAGCCGGACTCCCA-ATTTCGTTCATCACCCTTGG22723SRR13608004
322ATCGAACAGCCGGACTCCCA-ATTTCGTTCATCACCCTTGG22730SRR21814505
323ATCGACTAATTATAAGAGTT-AAAACGTGTCACAATCCAAT114669985SRR21814505
323ATCGACTAATTATAAGAGTT-AAAACGTGTCACAATCCAAT114805263SRR21814505
324ATCGTCGACCGGGTCCGAGG-ATTCTCGGACCCGGTCGACC21301SRR13608004
324ATCGTCGACCGGGTCCGAGG-ATTCTCGGACCCGGTCGACC314192562SRR13608004
325ATCTACTAAACCATATGACT-GAATTCTACAGATAACCTAG21244685SRR13608004
325ATCTACTAAACCATATGACT-GAATTCTACAGATAACCTAG312938353SRR13608004
326ATCTATCTTTTTATCAAAAA-TTGTAATCTCTTATGAGAAC113748430SRR21814493
326ATCTATCTTTTTATCAAAAA-TTGTAATCTCTTATGAGAAC115910982SRR21814493
327ATCTCGGTATTTCGTGCGCA-GTGGAATCGATGCCCATGGG22313SRR13608004
327ATCTCGGTATTTCGTGCGCA-GTGGAATCGATGCCCATGGG22436SRR21814495
328ATCTCTAACTCATATAATTA-GTTATCTAAACACTCCTAAT114670479SRR21814507SRR21814515
328ATCTCTAACTCATATAATTA-GTTATCTAAACACTCCTAAT44058552SRR13608004
329ATCTCTAACTCTTATAATTA-TGTTGTCTAAACACTCCTAA114837110SRR21814495SRR21814497
329ATCTCTAACTCTTATAATTA-TGTTGTCTAAACACTCCTAA115010652SRR21814495SRR21814497
330ATCTCTTATTTGAGAGAGTG-GTGGAATTCGACCCTTAAGT117407922SRR21814519
330ATCTCTTATTTGAGAGAGTG-GTGGAATTCGACCCTTAAGT23740774SRR21814519
331ATCTTAAAAGCCTAAGTAGT-ATTGAGTATAAGAACTTAAA511669116SRR21814512
331ATCTTAAAAGCCTAAGTAGT-ATTGAGTATAAGAACTTAAA511727903SRR13608004
332ATCTTTAACGGTGTCCAATC-GATTGGACACCGTTAAAGAT111610319SRR13608004
332ATCTTTAACGGTGTCCAATC-GATTGGACACCGTTAAAGAT111610321SRR13608004
333ATGACATCAAGTCATATTCG-TTAAGTTATTATACTCAATC511670215SRR13608004
333ATGACATCAAGTCATATTCG-TTAAGTTATTATACTCAATC512053421SRR13608004
334ATGACTTAATGTCATGTGTA-CTTTGGTTAGTGTTTTGGAG511664697SRR21814509
334ATGACTTAATGTCATGTGTA-CTTTGGTTAGTGTTTTGGAG511731586SRR21814509
335ATGAGTCATTGGCTTTGTAT-TTGATGGTGTAGCCGAAGTC23602818SRR21814508
335ATGAGTCATTGGCTTTGTAT-TTGATGGTGTAGCCGAAGTC42966976SRR21814508
336ATGATCTGATACCATTCCCT-TTGCTCTACTCGACCACACT114496286SRR13608004
336ATGATCTGATACCATTCCCT-TTGCTCTACTCGACCACACT512213487SRR21814499
337ATGATGAGAAATGGTATAAA-ACTATCCTAAACATGCAAAG113646678SRR21814510
337ATGATGAGAAATGGTATAAA-ACTATCCTAAACATGCAAAG114492009SRR13608004
338ATGCATTAGATTGTGACACA-ATCCATTTCTAACTCTTATA114745196SRR21814491
338ATGCATTAGATTGTGACACA-ATCCATTTCTAACTCTTATA115010994SRR21814491
339ATGCATTTGACTAATTATAA-TGGTCAAAATGTTTCAAAAT114932405SRR21814505
339ATGCATTTGACTAATTATAA-TGGTCAAAATGTTTCAAAAT44058984SRR21814505
340ATGGCTAACGTTTTTAAGTA-ATATGAGTCAGATTGATTGA113793424SRR21814505
340ATGGCTAACGTTTTTAAGTA-ATATGAGTCAGATTGATTGA115447238SRR21814505
341ATGGGAAAAATGTCGTTTAA-TTAAACGACATTTTTCCCAT56517039SRR21814501
341ATGGGAAAAATGTCGTTTAA-TTAAACGACATTTTTCCCAT56517044SRR21814501
342ATGGGTATAAGTGTTGTATA-TTGGTTTTAGCATCTTTTGG114671945SRR13608004
342ATGGGTATAAGTGTTGTATA-TTGGTTTTAGCATCTTTTGG114976117SRR13608004
343ATGGGTGAGCAAGAAAACCT-TCAATGTCTCTTATATATAT115876112SRR21814500
343ATGGGTGAGCAAGAAAACCT-TCAATGTCTCTTATATATAT116957917SRR13608004
344ATGGGTTGGGTCAACCCATA-TGGGTTGACCCAACCCATTT16455919SRR21814486SRR21814496SRR21814513
344ATGGGTTGGGTCAACCCATA-TGGGTTGACCCAACCCATTT16455926SRR21814486SRR21814496SRR21814513
345ATGGTGATTCCCAAGAACTT-TAGACGAAATCTCTAAACTA314493237SRR21814505
345ATGGTGATTCCCAAGAACTT-TAGACGAAATCTCTAAACTA511479864SRR21814505
346ATGTAGCCAAAGTCCATATG-ATTGCTTCTCAAAGCTTTCA23615359SRR13608004
346ATGTAGCCAAAGTCCATATG-ATTGCTTCTCAAAGCTTTCA313590083SRR13608004
347ATGTATGAACCTTGTGAACC-GTTCACAAGGTTCATACATT316642148SRR13608004
347ATGTATGAACCTTGTGAACC-GTTCACAAGGTTCATACATT316642158SRR13608004
348ATGTCATGTGTATGATTGAG-TTAGTGTTTTGGAGTAGAAT511860759SRR13608004
348ATGTCATGTGTATGATTGAG-TTAGTGTTTTGGAGTAGAAT512063872SRR13608004
349ATGTCTGTCTCTTATACACA-GTATAAGAGACAGATTTATT18091601SRR13608004
349ATGTCTGTCTCTTATACACA-GTATAAGAGACAGATTTATT24844102SRR13608004
349ATGTCTGTCTCTTATACACA-GTATAAGAGACAGATTTATT218648241SRR13608004
349ATGTCTGTCTCTTATACACA-GTATAAGAGACAGATTTATT521514626SRR13608004
350ATGTGAATGATTGAGTATAA-GGAGTCGAATATGACTTGAT511729109SRR13608004
350ATGTGAATGATTGAGTATAA-GGAGTCGAATATGACTTGAT512065210SRR13608004
351ATGTGGAGAGTATTTTACCA-TGGTAAAATACTCTCCACAT41532287SRR13608004
351ATGTGGAGAGTATTTTACCA-TGGTAAAATACTCTCCACAT41532293SRR13608004
352ATGTTAGAGTAAAATTCTTT-TCAAGTTTAACTTTCAACAC218360266SRR21814517
352ATGTTAGAGTAAAATTCTTT-TCAAGTTTAACTTTCAACAC316991929SRR21814517
353ATTAAGAGTGTTTAGACAAC-TAATTATAAGAGTTAAAGAT114602867SRR21814505
353ATTAAGAGTGTTTAGACAAC-TAATTATAAGAGTTAAAGAT44047732SRR21814505
354ATTATAAGAGTTAGAGATGG-TCACAATCCAATGCATTTGA114690301SRR21814501
354ATTATAAGAGTTAGAGATGG-TCACAATCCAATGCATTTGA115015896SRR21814501
355ATTCAAAAAAACCTAATCTA-ATTCTGAAATTTACAAACTA512872366SRR13608004
355ATTCAAAAAAACCTAATCTA-ATTCTGAAATTTACAAACTA512886212SRR13608004
356ATTCATGGGTTGAGTTGAGT-TCAAAAATTTCAACTCATTA111428328SRR21814494
356ATTCATGGGTTGAGTTGAGT-TCAAAAATTTCAACTCATTA117709629SRR21814494
357ATTCCACCCATTAATTTCTG-CTTCGAGTCCGCCCATTCCA41074428SRR21814507
357ATTCCACCCATTAATTTCTG-CTTCGAGTCCGCCCATTCCA41074430SRR21814507
358ATTCCAGAAGCCTAAAGTAG-ATAAGAACTAAAACCGCAAC115204363SRR21814499
358ATTCCAGAAGCCTAAAGTAG-ATAAGAACTAAAACCGCAAC42920478SRR21814499
359ATTCTCAAAGCTTTCATGGT-AAAAACACTAACCAACCTTC43042263SRR13608004
359ATTCTCAAAGCTTTCATGGT-AAAAACACTAACCAACCTTC511730663SRR13608004
360ATTCTCCTTTTCTTTATTTA-TTAAATAAAGAAAAGGAGAA112814516SRR13608004
360ATTCTCCTTTTCTTTATTTA-TTAAATAAAGAAAAGGAGAA112814520SRR13608004
361ATTGCCAATTGGGTGTTTCT-AACCGATTATCAATTTGGCG114260791SRR13608004
361ATTGCCAATTGGGTGTTTCT-AACCGATTATCAATTTGGCG115517710SRR21814493SRR21814509
362ATTGCGGTTTAAGTTCTTAT-ATTCTTACGCCTTTAAGATC44003250SRR13608004
362ATTGCGGTTTAAGTTCTTAT-ATTCTTACGCCTTTAAGATC511671066SRR21814505
362ATTGCGGTTTAAGTTCTTAT-ATTCTTACGCCTTTAAGATC511671421SRR21814505
363ATTGCGGTTTAAGTTCTTAT-GAAACACTATTTAGGCTTTT114510696SRR21814506
363ATTGCGGTTTAAGTTCTTAT-GAAACACTATTTAGGCTTTT43966917SRR21814506
364ATTGCGGTTTAAGTTCTTAT-TACAATTCTTACGCCTTTAA23621020SRR21814500
364ATTGCGGTTTAAGTTCTTAT-TACAATTCTTACGCCTTTAA43954143SRR13608004
365ATTGTGGATGTCGGATTCGG-TGCGGATTCCGACATCCACATAT1_ATH LTR/Gypsy27975619SRR21814508SRR21814512
365ATTGTGGATGTCGGATTCGG-TGCGGATTCCGACATCCACATAT1_ATH LTR/Gypsy38868398SRR21814511
365ATTGTGGATGTCGGATTCGG-TGCGGATTCCGACATCCACATAT1_ATH LTR/Gypsy48027701SRR13608004
366ATTGTTCTTCTTTTTCTTTT-AAAAGAAAAAGAAGAACAAT415904265SRR13608004
366ATTGTTCTTCTTTTTCTTTT-AAAAGAAAAAGAAGAACAAT415904269SRR13608004
367ATTGTTTGATGTCTTTATCT-AGATAAAGACATCAAACAAT312770803SRR13608004
367ATTGTTTGATGTCTTTATCT-AGATAAAGACATCAAACAAT312770807SRR13608004
368ATTTAAGTTCTTATACTCAA-ATTCTTACGCCTTTAAGATC43983374SRR13608004
368ATTTAAGTTCTTATACTCAA-ATTCTTACGCCTTTAAGATC43998277SRR13608004
369ATTTATTTCACAAAATGACT-ATTGTAAATAAGTCCCAACT12473267SRR21814518
369ATTTATTTCACAAAATGACT-ATTGTAAATAAGTCCCAACT112137643SRR21814518
370ATTTATTTTATTAATGTTGA-CCCGCCAATCCGTCCCGTAA110852809SRR13608004
370ATTTATTTTATTAATGTTGA-CCCGCCAATCCGTCCCGTAA124718865SRR21814513
371ATTTGACTAATTATAAGAGA-AAAATGTGTCACAATCTAAT114602896SRR21814499
371ATTTGACTAATTATAAGAGA-AAAATGTGTCACAATCTAAT114805262SRR21814499
372ATTTGGCTACACCATGAAAG-GACACAAAGCCATAGACTCA44003187SRR21814486
372ATTTGGCTACACCATGAAAG-GACACAAAGCCATAGACTCA511723619SRR21814486
373ATTTGGCTTTGTATCTTCTA-ATGGTGTAGCCAAAGTCCGT114510498SRR13608004
373ATTTGGCTTTGTATCTTCTA-ATGGTGTAGCCAAAGTCCGT43976733SRR13608004
374ATTTGTATCTTCTAACAAGG-ACAAAGTCCATATGAGTCTT42922483SRR13608004
374ATTTGTATCTTCTAACAAGG-ACAAAGTCCATATGAGTCTT43969642SRR13608004
375ATTTGTATCTTCTAACAAGG-CAGAAGTCCATATGAGTCTT313592368SRR13608004
375ATTTGTATCTTCTAACAAGG-CAGAAGTCCATATGAGTCTT43969642SRR13608004
375ATTTGTATCTTCTAACAAGG-CAGAAGTCCATATGAGTCTT44001959SRR13608004
376ATTTTAAAAGATTTACAAGA-GGGTTTTAAAATATTTACAA47578359SRR21814486
376ATTTTAAAAGATTTACAAGA-GGGTTTTAAAATATTTACAA516014802SRR21814486
377ATTTTAGATATGGTTCATTT-AAATGAACCATATCTAAAAT2887131SRR13608004
377ATTTTAGATATGGTTCATTT-AAATGAACCATATCTAAAAT2887138SRR13608004
378ATTTTAGCAAATAAATCCTA-TAATCTACATATACATTTTT113869896SRR21814488
378ATTTTAGCAAATAAATCCTA-TAATCTACATATACATTTTT59298149SRR21814488
379ATTTTGACAATAAAAACACT-TCAAATGCATTGGATTGTGA114719502SRR13608004
379ATTTTGACAATAAAAACACT-TCAAATGCATTGGATTGTGA114973782SRR21814508
380ATTTTGTGAAATAAATCCTA-CTACATATACATTTTTGCAG121335967SRR21814517
380ATTTTGTGAAATAAATCCTA-CTACATATACATTTTTGCAG22299090SRR21814517
381ATTTTTGGCGGGAAAATTAC-TTTTTGGCGAGAAAATTACG125098351SRR21814486
381ATTTTTGGCGGGAAAATTAC-TTTTTGGCGAGAAAATTACG127860534SRR21814486
382ATTTTTTTCTCAGCCAAAAA-AAATCCCGCCAAAACTTTTT118302180SRR21814492SRR21814493
382ATTTTTTTCTCAGCCAAAAA-AAATCCCGCCAAAACTTTTT118302181SRR13608004
383CAAAAAAACGTAAACCCGTG-AAACGTAAATCCGTAATTTT110526697SRR13608004
383CAAAAAAACGTAAACCCGTG-AAACGTAAATCCGTAATTTT111427810SRR21814491
384CAAAAACGTAAACCCGTGAT-ACGTAAACCCGTAATTTTCC15966468SRR21814518
384CAAAAACGTAAACCCGTGAT-ACGTAAACCCGTAATTTTCC310406786SRR13608004
385CAAAAATGTATATGTAGATA-CAGGATTTATTTCACAAAAT111783018SRR13608004
385CAAAAATGTATATGTAGATA-CAGGATTTATTTCACAAAAT48958001SRR21814500
385CAAAAATGTATATGTAGATA-CAGGATTTATTTCACAAAAT413124435SRR21814492
386CAAAACACTAACAAACCTTC-ACATGACATCAAGTTATATT511705910SRR13608004
386CAAAACACTAACAAACCTTC-ACATGACATCAAGTTATATT511825501SRR21814503
387CAAAACACTAACCAAGCTTC-TGCATCTAGTCATATTTGAC115160567SRR21814505
387CAAAACACTAACCAAGCTTC-TGCATCTAGTCATATTTGAC115166618SRR21814505
388CAAAACCGCCTCAAGTCTCT-GATCCCCAAGATCGAGCATC113917934SRR13608004
388CAAAACCGCCTCAAGTCTCT-GATCCCCAAGATCGAGCATC315108414SRR13608004
389CAAAATCGCAAAATCATATT-ACCGCAAAATCATATTTTCC125723013SRR21814500SRR21814501
389CAAAATCGCAAAATCATATT-ACCGCAAAATCATATTTTCC47102263SRR21814500SRR21814501
390CAAACCCGTCCCGTTAAAAA-TTGTTATTAAGTAACGTCCT112993145SRR21814511
390CAAACCCGTCCCGTTAAAAA-TTGTTATTAAGTAACGTCCT117606002SRR13608004
391CAAACGCTAACCAAGATTCT-CTCATCTAGTCATATTTCAC115088414SRR21814508
391CAAACGCTAACCAAGATTCT-CTCATCTAGTCATATTTCAC115088909SRR21814508
392CAAAGCTTTCATGGTGTAGC-CACTAACCAAGCTTCTTCTT23606158SRR21814514
392CAAAGCTTTCATGGTGTAGC-CACTAACCAAGCTTCTTCTT512027711SRR13608004
393CAAATAAAGCTCTAATGGTA-GATCCCATCTACCCAAAGTA113941621SRR21814507
393CAAATAAAGCTCTAATGGTA-GATCCCATCTACCCAAAGTA114180202SRR21814507
394CAAATATGTTGCTTGTTTCA-TTTGTTGTGTTTATGCTTTC114207667SRR21814486
394CAAATATGTTGCTTGTTTCA-TTTGTTGTGTTTATGCTTTC116407416SRR13608004
395CAACAACAACAACAACAAAA-AACAAAAACAACAACAACAA218934166SRR21814503
395CAACAACAACAACAACAAAA-AACAAAAACAACAACAACAA523608882SRR21814503
396CAACAACAACAACAACAACA-GCCACAACAACAACAACAAC18321714SRR21814503
396CAACAACAACAACAACAACA-GCCACAACAACAACAACAAC129733815SRR21814503
397CAACAACAACAACAACAACA-TACAACAACAACAACAACAAATRE1 LTR/Copia111784680SRR21814518
397CAACAACAACAACAACAACA-TACAACAACAACAACAACAAATRE1 LTR/Copia129733821SRR21814518
398CAACCAATACCTTGATACAG-GTTAAAGCCAAAATGCTCCC113645366SRR21814515
398CAACCAATACCTTGATACAG-GTTAAAGCCAAAATGCTCCC41764523SRR21814515
399CAAGAAGAAAGTTGGTTAGT-GGCTAAACCATCAAAGCTTT115263996SRR21814505
399CAAGAAGAAAGTTGGTTAGT-GGCTAAACCATCAAAGCTTT511702768SRR21814505
400CAAGCAATTATACGAAATTA-TAATTTCGTATAATTGCTTG113995540SRR13608004
400CAAGCAATTATACGAAATTA-TAATTTCGTATAATTGCTTG113995546SRR13608004
401CAAGTAATATTCGACTCCAA-TAATACTCAATCATACACAT114544806SRR13608004
401CAAGTAATATTCGACTCCAA-TAATACTCAATCATACACAT511790054SRR13608004
402CAATACTTAGGTTTTTAAGA-TCTTCTTTGTATCTTCTAAC511661020SRR21814510
402CAATACTTAGGTTTTTAAGA-TCTTCTTTGTATCTTCTAAC512054188SRR21814510
403CAATCACCTATAAACTGAGG-TATGGTTAATTTATTGAGCA114500791SRR13608004
403CAATCACCTATAAACTGAGG-TATGGTTAATTTATTGAGCA23605189SRR13608004
404CAATCTTATAAGCCTAAGTA-ATATAAGAACTTAAACCGCA23621020SRR21814492
404CAATCTTATAAGCCTAAGTA-ATATAAGAACTTAAACCGCA23622087SRR13608004
405CAATGGACATGCTCTTAGAG-TTAAGAAACTTGTAAGGTCC3557537SRR21814511
405CAATGGACATGCTCTTAGAG-TTAAGAAACTTGTAAGGTCC3557538SRR13608004
406CAATGTTTTCACGCCCGACC-GGTCGGGCGTGAAAACATTG39184661SRR21814499
406CAATGTTTTCACGCCCGACC-GGTCGGGCGTGAAAACATTG39184668SRR21814499
406CAATGTTTTCACGCCCGACC-GGTCGGGCGTGAAAACATTG52882309SRR21814509
406CAATGTTTTCACGCCCGACC-GGTCGGGCGTGAAAACATTG52882316SRR21814509
406CAATGTTTTCACGCCCGACC-GGTCGGGCGTGAAAACATTG59887196SRR21814512
406CAATGTTTTCACGCCCGACC-GGTCGGGCGTGAAAACATTG59887203SRR21814512
406CAATGTTTTCACGCCCGACC-GGTCGGGCGTGAAAACATTG517967133SRR21814512
406CAATGTTTTCACGCCCGACC-GGTCGGGCGTGAAAACATTG517967140SRR21814512
406CAATGTTTTCACGCCCGACC-GGTCGGGCGTGAAAACATTG524101819SRR21814512
406CAATGTTTTCACGCCCGACC-GGTCGGGCGTGAAAACATTG524101826SRR21814512
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG14998446SRR21814490
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG18569731SRR21814496
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG19210082SRR21814506
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG111396055SRR21814504
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG118138184SRR21814496
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG120665006SRR21814494
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG122776086SRR21814516
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG122946083SRR21814490
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG124123672SRR21814496
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG124425574SRR21814494
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG22327272SRR21814504
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG29753048SRR21814496
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG34747032SRR21814516
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG38120252SRR21814506
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG311101586SRR21814516
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG311299731SRR21814490
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG47083580SRR21814514
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG48174492SRR21814496
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG411441966SRR21814497
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG411473677SRR21814496
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG411474826SRR21814496
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG416407025SRR21814497
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG417351534SRR21814506
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG51450725SRR21814514
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG54926152SRR21814509
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG56138312SRR21814509
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG59908149SRR21814509
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG517541962SRR21814487SRR21814490
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG518789059SRR21814509
407CAATGTTTTGAAACCCGACC-GGTCGGGCGTGAAAACACTG521111256SRR21814487
408CAATGTTTTGAAACCCGACC-GTCGGGCGTGAAAACACTGA3188173SRR21814507
408CAATGTTTTGAAACCCGACC-GTCGGGCGTGAAAACACTGA51871386SRR21814507
409CAATGTTTTGAAACCCGACC-GTCGGGCGTGAAAACACTGG318814707SRR21814515
409CAATGTTTTGAAACCCGACC-GTCGGGCGTGAAAACACTGG517557013SRR21814515
410CAATGTTTTGAAACCCGACC-TCGGGCGTGAAAACACTGGT213539958SRR21814512
410CAATGTTTTGAAACCCGACC-TCGGGCGTGAAAACACTGGT416241737SRR21814512
411CAATGTTTTTAAAACCGACC-GGTCGGGCGTGAAAACACTG124459726SRR21814492SRR21814493
411CAATGTTTTTAAAACCGACC-GGTCGGGCGTGAAAACACTG128012294SRR21814492SRR21814493
411CAATGTTTTTAAAACCGACC-GGTCGGGCGTGAAAACACTG218906826SRR21814495
411CAATGTTTTTAAAACCGACC-GGTCGGGCGTGAAAACACTG318551757SRR21814495
411CAATGTTTTTAAAACCGACC-GGTCGGGCGTGAAAACACTG319936926SRR21814486
411CAATGTTTTTAAAACCGACC-GGTCGGGCGTGAAAACACTG321027012SRR21814495
411CAATGTTTTTAAAACCGACC-GGTCGGGCGTGAAAACACTG321833275SRR21814486SRR21814495
411CAATGTTTTTAAAACCGACC-GGTCGGGCGTGAAAACACTG411475736SRR21814492SRR21814493
412CAATGTTTTTAAAACCGACC-GTCGGGCGTGAAAACACTGA216446917SRR21814501
412CAATGTTTTTAAAACCGACC-GTCGGGCGTGAAAACACTGA57422116SRR21814501
412CAATGTTTTTAAAACCGACC-GTCGGGCGTGAAAACACTGA59712787SRR21814501
413CAATGTTTTTAAAACCGACC-TCGGGCGTGAAAACACTGCT124459726SRR21814505
413CAATGTTTTTAAAACCGACC-TCGGGCGTGAAAACACTGCT56106763SRR21814505
414CAATGTTTTTAAACCCGACC-GGTCGGGCATGAAAACACTG19083600SRR21814486
414CAATGTTTTTAAACCCGACC-GGTCGGGCATGAAAACACTG112725130SRR13608004
414CAATGTTTTTAAACCCGACC-GGTCGGGCATGAAAACACTG112726147SRR21814506
414CAATGTTTTTAAACCCGACC-GGTCGGGCATGAAAACACTG112726841SRR21814506
414CAATGTTTTTAAACCCGACC-GGTCGGGCATGAAAACACTG125593766SRR21814515
414CAATGTTTTTAAACCCGACC-GGTCGGGCATGAAAACACTG214827302SRR21814496
414CAATGTTTTTAAACCCGACC-GGTCGGGCATGAAAACACTG217787420SRR21814510SRR21814511
414CAATGTTTTTAAACCCGACC-GGTCGGGCATGAAAACACTG33401231SRR21814494
414CAATGTTTTTAAACCCGACC-GGTCGGGCATGAAAACACTG311001155SRR21814504SRR21814507
414CAATGTTTTTAAACCCGACC-GGTCGGGCATGAAAACACTG321255605SRR21814509
414CAATGTTTTTAAACCCGACC-GGTCGGGCATGAAAACACTG322076003SRR21814516
414CAATGTTTTTAAACCCGACC-GGTCGGGCATGAAAACACTG413027722SRR21814504
414CAATGTTTTTAAACCCGACC-GGTCGGGCATGAAAACACTG518052015SRR21814515
415CACAAGATAGCAAGCCACCA-TGTTCACACAAGATAGCAAG44836452SRR13608004
415CACAAGATAGCAAGCCACCA-TGTTCACACAAGATAGCAAG44982384SRR13608004
416CACACACACACACACACACA-CACACACACACACACACATA16092916SRR21814503
416CACACACACACACACACACA-CACACACACACACACACATA112423461SRR21814503
416CACACACACACACACACACA-CACACACACACACACACATA120506958SRR21814503
416CACACACACACACACACACA-CACACACACACACACACATA35568368SRR21814503
416CACACACACACACACACACA-CACACACACACACACACATA39083938SRR21814503
416CACACACACACACACACACA-CACACACACACACACACATA39083940SRR21814503
416CACACACACACACACACACA-CACACACACACACACACATA318673526SRR21814503
416CACACACACACACACACACA-CACACACACACACACACATA47898520SRR21814503
416CACACACACACACACACACA-CACACACACACACACACATA414234964SRR21814503
416CACACACACACACACACACA-CACACACACACACACACATA521492181SRR21814503
416CACACACACACACACACACA-CACACACACACACACACATA521492183SRR21814503
416CACACACACACACACACACA-CACACACACACACACACATA521492185SRR21814503
417CACATGACATCAAATCATAT-TTGCGGTTTTAGTTTTTATA43045589SRR21814491
417CACATGACATCAAATCATAT-TTGCGGTTTTAGTTTTTATA511865643SRR21814491
418CACCATCAAAGTTTTGAGAA-GCCAAAGACTCATACGGACT114486704SRR13608004
418CACCATCAAAGTTTTGAGAA-GCCAAAGACTCATACGGACT115149237SRR21814493
419CACGAGTATAGAACAAAGGC-CAGTAAAGAACTTAACAAGA113737259SRR13608004
419CACGAGTATAGAACAAAGGC-CAGTAAAGAACTTAACAAGA22718217SRR13608004
420CACTAACCAAGCTTCTTCTT-ACATCAAGTCATATTCGACT115599627SRR13608004
420CACTAACCAAGCTTCTTCTT-ACATCAAGTCATATTCGACT42966497SRR21814500
421CACTACAAAAAAAGTCCTCA-TGTTGATATTTGTTGTAGTGATENSPM3 DNA/En-Spm117653178SRR21814494SRR21814495SRR21814496SRR21814498SRR21814499SRR21814512SRR21814517SRR21814518
421CACTACAAAAAAAGTCCTCA-TGTTGATATTTGTTGTAGTGATENSPM3 DNA/En-Spm118704581SRR13608004
422CACTACAACAAATATCAACA-TGAGGACTTTTTTTGTAGTG117653176SRR21814494SRR21814495SRR21814496SRR21814498SRR21814499SRR21814512SRR21814517SRR21814518
422CACTACAACAAATATCAACA-TGAGGACTTTTTTTGTAGTG118704579SRR13608004
423CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGATENSPM5 DNA/En-Spm111961875SRR21814489SRR21814509
423CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGATENSPM5 DNA/En-Spm116513873SRR21814493SRR21814495
423CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGATENSPM5 DNA/En-Spm23044561SRR21814490SRR21814495
423CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGATENSPM5 DNA/En-Spm28099376SRR21814508SRR21814518
423CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGATENSPM5 DNA/En-Spm37421566SRR21814495
423CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGATENSPM5 DNA/En-Spm314872541SRR21814494SRR21814495
423CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGATENSPM5 DNA/En-Spm315847376SRR21814508
423CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGATENSPM5 DNA/En-Spm316410182SRR21814508
423CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGATENSPM5 DNA/En-Spm316900669SRR21814493SRR21814494
423CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGATENSPM5 DNA/En-Spm45125758SRR21814487SRR21814508
423CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGATENSPM5 DNA/En-Spm46899510SRR21814489SRR21814509
423CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGATENSPM5 DNA/En-Spm515558532SRR21814494SRR21814518
423CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGATENSPM5 DNA/En-Spm516517824SRR21814487SRR21814490
423CACTACAAGAAAACAGACAA-TCACCTGTTTTCTTGTAGTGATENSPM5 DNA/En-Spm516611687SRR21814493
424CACTACAAGAAAACAGGTAA-TCACCTGTTTTCTTGTAGTGATENSPM6 DNA/En-Spm22953379SRR21814488SRR21814516
424CACTACAAGAAAACAGGTAA-TCACCTGTTTTCTTGTAGTGATENSPM6 DNA/En-Spm26588661SRR21814488
424CACTACAAGAAAACAGGTAA-TCACCTGTTTTCTTGTAGTGATENSPM6 DNA/En-Spm28560477SRR21814516
424CACTACAAGAAAACAGGTAA-TCACCTGTTTTCTTGTAGTGATENSPM6 DNA/En-Spm313161634SRR21814516
424CACTACAAGAAAACAGGTAA-TCACCTGTTTTCTTGTAGTGATENSPM6 DNA/En-Spm521034315SRR21814516
425CACTACAAGAAAACAGGTGA-TTACCTGTTTTCTTGTAGTG22953381SRR21814488SRR21814516
425CACTACAAGAAAACAGGTGA-TTACCTGTTTTCTTGTAGTG26588659SRR21814488
425CACTACAAGAAAACAGGTGA-TTACCTGTTTTCTTGTAGTG28560479SRR21814516
425CACTACAAGAAAACAGGTGA-TTACCTGTTTTCTTGTAGTG313161636SRR21814516
425CACTACAAGAAAACAGGTGA-TTACCTGTTTTCTTGTAGTG521034313SRR21814516
426CACTACAAGAAAACAGGTGA-TTGTCTGTTTTCTTGTAGTG111961877SRR21814489SRR21814509
426CACTACAAGAAAACAGGTGA-TTGTCTGTTTTCTTGTAGTG116513871SRR21814493SRR21814494
426CACTACAAGAAAACAGGTGA-TTGTCTGTTTTCTTGTAGTG23044563SRR21814490SRR21814495
426CACTACAAGAAAACAGGTGA-TTGTCTGTTTTCTTGTAGTG28099374SRR21814508
426CACTACAAGAAAACAGGTGA-TTGTCTGTTTTCTTGTAGTG37421564SRR21814495
426CACTACAAGAAAACAGGTGA-TTGTCTGTTTTCTTGTAGTG314872543SRR21814494SRR21814495
426CACTACAAGAAAACAGGTGA-TTGTCTGTTTTCTTGTAGTG315847378SRR21814508
426CACTACAAGAAAACAGGTGA-TTGTCTGTTTTCTTGTAGTG316410180SRR21814508
426CACTACAAGAAAACAGGTGA-TTGTCTGTTTTCTTGTAGTG316900671SRR21814493SRR21814494
426CACTACAAGAAAACAGGTGA-TTGTCTGTTTTCTTGTAGTG45125760SRR21814508
426CACTACAAGAAAACAGGTGA-TTGTCTGTTTTCTTGTAGTG46899508SRR21814489SRR21814509
426CACTACAAGAAAACAGGTGA-TTGTCTGTTTTCTTGTAGTG515558530SRR21814494
426CACTACAAGAAAACAGGTGA-TTGTCTGTTTTCTTGTAGTG516517822SRR21814490
426CACTACAAGAAAACAGGTGA-TTGTCTGTTTTCTTGTAGTG516611685SRR21814493
427CACTACAAGAAAACAGTTAA-ATGGCAATTTTCTTGTAGTGATENSPM9 DNA/En-Spm26007112SRR21814492SRR21814493SRR21814496SRR21814501SRR21814506SRR21814508SRR21814516
427CACTACAAGAAAACAGTTAA-ATGGCAATTTTCTTGTAGTGATENSPM9 DNA/En-Spm28545985SRR21814508
427CACTACAAGAAAACAGTTAA-ATGGCAATTTTCTTGTAGTGATENSPM9 DNA/En-Spm218040046SRR21814492SRR21814493SRR21814496SRR21814501SRR21814506SRR21814516
427CACTACAAGAAAACAGTTAA-ATGGCAATTTTCTTGTAGTGATENSPM9 DNA/En-Spm315679035SRR21814506SRR21814508
428CACTACAAGAAAATTGCCAT-TTAACTGTTTTCTTGTAGTG26007110SRR21814492SRR21814493SRR21814496SRR21814501SRR21814506SRR21814508SRR21814516
428CACTACAAGAAAATTGCCAT-TTAACTGTTTTCTTGTAGTG28545983SRR21814508
428CACTACAAGAAAATTGCCAT-TTAACTGTTTTCTTGTAGTG218040044SRR21814492SRR21814493SRR21814496SRR21814501SRR21814506SRR21814516
428CACTACAAGAAAATTGCCAT-TTAACTGTTTTCTTGTAGTG315679033SRR21814506SRR21814508
429CACTACAAGAAATATCTACA-TGTAGATATTTCTTGTAGTG42630485SRR21814497SRR21814504SRR21814507
429CACTACAAGAAATATCTACA-TGTAGATATTTCTTGTAGTG42630487SRR21814497SRR21814504SRR21814507
430CACTACAAGAAATTTGTTCA-TGAACAAATTTCTTGTAGTG46180957SRR21814488SRR21814489SRR21814494SRR21814495SRR21814503SRR21814505SRR21814509SRR21814511SRR21814514SRR21814515SRR21814518
430CACTACAAGAAATTTGTTCA-TGAACAAATTTCTTGTAGTG46180959SRR21814488SRR21814489SRR21814494SRR21814495SRR21814503SRR21814505SRR21814509SRR21814511SRR21814514SRR21814515SRR21814518
431CACTATCAAAGCTTTGAGAA-CAAAGACTCATACGTACTTC117490727SRR13608004
431CACTATCAAAGCTTTGAGAA-CAAAGACTCATACGTACTTC23661042SRR13608004
432CACTATCAAAGCTTTGAGAA-CCAAAGACTCATACGTACTT117490727SRR13608004
432CACTATCAAAGCTTTGAGAA-CCAAAGACTCATACGTACTT23661042SRR13608004
433CACTCATACGGACTTTGGCT-TCCTTGTTAGAAGACACAAA43968468SRR13608004
433CACTCATACGGACTTTGGCT-TCCTTGTTAGAAGACACAAA511733608SRR13608004
434CAGACATTTCAATGTATGTT-TTTCTTTTTTTTTGGCACCG21809SRR13608004
434CAGACATTTCAATGTATGTT-TTTCTTTTTTTTTGGCACCG314194193SRR21814496
435CAGACTTGTCCAAAACGCCC-GGGCGTTTTGGACAAGTCTG29728SRR13608004
435CAGACTTGTCCAAAACGCCC-GGGCGTTTTGGACAAGTCTG29735SRR13608004
436CAGAGCTTTTACAATATGAA-TTGGACTTTTGTATTGATTA25041388SRR21814515
436CAGAGCTTTTACAATATGAA-TTGGACTTTTGTATTGATTA41944187SRR13608004
437CAGCACTCAAGAAACATATA-AAAAATTAAGAGATGATTAG114270467SRR21814519
437CAGCACTCAAGAAACATATA-AAAAATTAAGAGATGATTAG23899181SRR13608004
438CAGCTACACCATCAAAGCTT-ACAAAGTCAAAGACTCATAC23619310SRR21814505
438CAGCTACACCATCAAAGCTT-ACAAAGTCAAAGACTCATAC511669230SRR21814505
439CAGGAGGGCGTTTAGTATAT-ATATACTAAACGCCCTCCTG112714450SRR13608004
439CAGGAGGGCGTTTAGTATAT-ATATACTAAACGCCCTCCTG112714459SRR13608004
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT14998439SRR21814490
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT18569738SRR21814496
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT19210089SRR21814506
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT111396048SRR21814504
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT118138177SRR21814496
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT120665013SRR21814494
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT122946090SRR21814490
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT124123665SRR21814496
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT124425581SRR21814494
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT22327265SRR21814504
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT29753041SRR21814496
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT38120259SRR21814506
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT311299724SRR21814490
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT47083573SRR21814514
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT48174485SRR21814496
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT411441973SRR21814497
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT411473684SRR21814496
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT411474819SRR21814496
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT416407018SRR21814497
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT417351527SRR21814506
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT51450732SRR21814514
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT56138305SRR21814509
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT59908156SRR21814509
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT517541969SRR21814487SRR21814490
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT518789066SRR21814509
440CAGTGTTTTCACGCCCGACC-GGTCGGGTTTCAAAACATTGTAG3N1 DNA/HAT521111249SRR21814487
441CAGTGTTTTCACGCCCGACC-GGTCGGTTTTAAAAACATTGTAG3N1 DNA/HAT124459733SRR21814492SRR21814493
441CAGTGTTTTCACGCCCGACC-GGTCGGTTTTAAAAACATTGTAG3N1 DNA/HAT128012301SRR21814492SRR21814493
441CAGTGTTTTCACGCCCGACC-GGTCGGTTTTAAAAACATTGTAG3N1 DNA/HAT319936933SRR21814486
441CAGTGTTTTCACGCCCGACC-GGTCGGTTTTAAAAACATTGTAG3N1 DNA/HAT321833282SRR21814486
441CAGTGTTTTCACGCCCGACC-GGTCGGTTTTAAAAACATTGTAG3N1 DNA/HAT411475729SRR21814492SRR21814493
442CAGTGTTTTCACGCCCGACC-GTCGGGTTTCAAAACATTGCTAG3N1 DNA/HAT3188166SRR21814508
442CAGTGTTTTCACGCCCGACC-GTCGGGTTTCAAAACATTGCTAG3N1 DNA/HAT519818789SRR21814508
443CAGTGTTTTCACGCCCGACC-GTCGGTTTTAAAAACATTGG411586507SRR21814516
443CAGTGTTTTCACGCCCGACC-GTCGGTTTTAAAAACATTGG57457269SRR21814516
444CAGTGTTTTCACGCCTGACC-GTCGGGTTTCAAAACATTGG14409107SRR21814516
444CAGTGTTTTCACGCCTGACC-GTCGGGTTTCAAAACATTGG318059889SRR21814516
445CAGTGTTTTCATGCCCGACC-GGTCGGGTTTAAAAACATTGTAG3N1 DNA/HAT112726140SRR21814506
445CAGTGTTTTCATGCCCGACC-GGTCGGGTTTAAAAACATTGTAG3N1 DNA/HAT112726848SRR21814506
445CAGTGTTTTCATGCCCGACC-GGTCGGGTTTAAAAACATTGTAG3N1 DNA/HAT125593773SRR21814515
445CAGTGTTTTCATGCCCGACC-GGTCGGGTTTAAAAACATTGTAG3N1 DNA/HAT311001162SRR21814504
445CAGTGTTTTCATGCCCGACC-GGTCGGGTTTAAAAACATTGTAG3N1 DNA/HAT413027729SRR21814504
445CAGTGTTTTCATGCCCGACC-GGTCGGGTTTAAAAACATTGTAG3N1 DNA/HAT518052022SRR21814515
446CATAAAAGCCTAAGTAGTGT-ATAACAACTTAAACCGCAAC114363472SRR21814505
446CATAAAAGCCTAAGTAGTGT-ATAACAACTTAAACCGCAAC512045196SRR13608004
447CATAAAAGCCTAAGTAGTGT-GGAGTATAAGAACTTAAACC43976604SRR13608004
447CATAAAAGCCTAAGTAGTGT-GGAGTATAAGAACTTAAACC512045196SRR13608004
448CATAAACCCTAAACCCTAAA-CCTAAACCATAAACCCTAAA115089060SRR13608004
448CATAAACCCTAAACCCTAAA-CCTAAACCATAAACCCTAAA115300140SRR13608004
449CATAAAGTCATATTCGACTC-TTCTAATACTCAATCATACA23620271SRR21814519
449CATAAAGTCATATTCGACTC-TTCTAATACTCAATCATACA511790057SRR13608004
450CATACAAAGCCAAAGACTCA-AAAGTAGTGTTTCCTTGTTA42922116SRR13608004
450CATACAAAGCCAAAGACTCA-AAAGTAGTGTTTCCTTGTTA511795089SRR13608004
451CATAGGTAATTGGTTGCAAA-GCAAAAATTGAGAGTTGGTA512806080SRR21814503
451CATAGGTAATTGGTTGCAAA-GCAAAAATTGAGAGTTGGTA512872669SRR21814503
452CATATTCGACTCCAAAACAC-GTGTTTTGGAGTCGAATATG27024SRR21814519
452CATATTCGACTCCAAAACAC-GTGTTTTGGAGTCGAATATG27031SRR21814519
453CATCAAAGCTTTAAGAAGCA-CAAAGACTCATATGGACTTT115587516SRR13608004
453CATCAAAGCTTTAAGAAGCA-CAAAGACTCATATGGACTTT43967732SRR21814509
454CATCAAGATTCTGTACTGTG-CACAGTACAGAATCTTGATG113441852SRR13608004
454CATCAAGATTCTGTACTGTG-CACAGTACAGAATCTTGATG113441860SRR13608004
455CATCAAGTCATATTCGACTC-TTCTTATACTCAATCATACA511660386SRR21814505
455CATCAAGTCATATTCGACTC-TTCTTATACTCAATCATACA512043555SRR21814505
456CATCATCATCATCATCATCA-ATCATCATCATCATCATCACVANDAL1 DNA/MuDR110114453SRR21814513
456CATCATCATCATCATCATCA-ATCATCATCATCATCATCACVANDAL1 DNA/MuDR111363957SRR21814513
456CATCATCATCATCATCATCA-ATCATCATCATCATCATCACVANDAL1 DNA/MuDR516009465SRR21814513
457CATCGACCATTCATCGTCCT-AAAAGTTTACCGGGTCCGAG21468SRR13608004
457CATCGACCATTCATCGTCCT-AAAAGTTTACCGGGTCCGAG314191895SRR13608004
458CATCTAAGTATTGAAGAATC-GATTCTTCAATACTTAGATG117205136SRR13608004
458CATCTAAGTATTGAAGAATC-GATTCTTCAATACTTAGATG117205145SRR13608004
459CATGACATCAAGTCATATTC-TTCTAGTTCTTATACTCAAT42920087SRR13608004
459CATGACATCAAGTCATATTC-TTCTAGTTCTTATACTCAAT512028828SRR13608004
460CATGATGATAGTTATCATCA-TTTAACGTGGGGTATGATGA112950832SRR13608004
460CATGATGATAGTTATCATCA-TTTAACGTGGGGTATGATGA113132375SRR13608004
461CATTATTTGGAACGATCAAT-AGGAATGTTTCCTATGACCC114212030SRR21814489
461CATTATTTGGAACGATCAAT-AGGAATGTTTCCTATGACCC44140437SRR21814489
462CATTGTTAGAAGATACAAAG-ATTAAAAGCCTAAGTAGTGT23618203SRR13608004
462CATTGTTAGAAGATACAAAG-ATTAAAAGCCTAAGTAGTGT43026178SRR13608004
463CATTGTTTGATGTCTTTATC-GATAAAGACATCAAACAATG312770804SRR13608004
463CATTGTTTGATGTCTTTATC-GATAAAGACATCAAACAATG312770806SRR13608004
464CATTTGTCATCACTTTGCAT-ATCACTGTTTTATACCATTT113646682SRR21814506
464CATTTGTCATCACTTTGCAT-ATCACTGTTTTATACCATTT45010073SRR13608004
465CATTTTACTAATTATAAGAG-TGGTCAAAATGTGTCACAAT114690477SRR21814486
465CATTTTACTAATTATAAGAG-TGGTCAAAATGTGTCACAAT114998566SRR13608004
466CATTTTAGCAAATAAATCCT-ATCTATATATACATTTTTAC110221861SRR21814515
466CATTTTAGCAAATAAATCCT-ATCTATATATACATTTTTAC128891908SRR21814515
467CCAAAAGATGCTAAAACCAA-TATACAACACTTATACCCAT114671950SRR13608004
467CCAAAAGATGCTAAAACCAA-TATACAACACTTATACCCAT114976112SRR13608004
468CCAAAAGCTAAAGTAGGATT-ACAAGAACTAGAACCGCAAC115253320SRR21814505
468CCAAAAGCTAAAGTAGGATT-ACAAGAACTAGAACCGCAAC42920481SRR21814505
469CCAAAGACTCATACGGACTT-ATCCTTGTTAGAAGACACAA23717505SRR21814505
469CCAAAGACTCATACGGACTT-ATCCTTGTTAGAAGACACAA512052789SRR13608004
470CCAAAGTCCGTATGAGTCTT-TTCTCAAAGCTTTCATGGTG114484281SRR21814514
470CCAAAGTCCGTATGAGTCTT-TTCTCAAAGCTTTCATGGTG115089843SRR13608004
471CCAACCTTCTTCTTGCTTCT-AGAAGCAAGAAGAAGGTTGG28564SRR21814509
471CCAACCTTCTTCTTGCTTCT-AGAAGCAAGAAGAAGGTTGG28565SRR21814509
472CCAACCTTCTTCTTGCTTCT-AGTCATATTCGACTCCAAAA115600858SRR21814505
472CCAACCTTCTTCTTGCTTCT-AGTCATATTCGACTCCAAAA42957898SRR21814505
472CCAACCTTCTTCTTGCTTCT-AGTCATATTCGACTCCAAAA43978279SRR21814505
472CCAACCTTCTTCTTGCTTCT-AGTCATATTCGACTCCAAAA511672560SRR21814505
473CCAACCTTCTTCTTTCTTCT-TGTCATATTCGACTCCAAAA313642120SRR21814504
473CCAACCTTCTTCTTTCTTCT-TGTCATATTCGACTCCAAAA511733488SRR21814504
474CCAAGAAAAAGAAAAGCTCT-AGAGCTTTTCTTTTTCTTGG2536603SRR13608004
474CCAAGAAAAAGAAAAGCTCT-AGAGCTTTTCTTTTTCTTGG2536608SRR13608004
475CCAAGACTCGATTACAAAAC-ATGTTTTGTAATCGAGTCTT113178657SRR13608004
475CCAAGACTCGATTACAAAAC-ATGTTTTGTAATCGAGTCTT113178664SRR13608004
476CCAATGTTTTGAAACCCGAC-GGTCAGGCGTGAAAACACTG14409101SRR21814516
476CCAATGTTTTGAAACCCGAC-GGTCAGGCGTGAAAACACTG318059895SRR21814516
477CCAATGTTTTGAAACCCGAC-GTCGGGCGTGAAAACACTGG130180780SRR21814495
477CCAATGTTTTGAAACCCGAC-GTCGGGCGTGAAAACACTGG517038936SRR21814495
478CCAATGTTTTGAAACCCGAC-GTCGGGTTTCAAAACATTGG320560690SRR21814509SRR21814517
478CCAATGTTTTGAAACCCGAC-GTCGGGTTTCAAAACATTGG320560696SRR21814509SRR21814517
479CCAATGTTTTTAAAACCGAC-GGTCGGGCGTGAAAACACTG322028059SRR21814500
479CCAATGTTTTTAAAACCGAC-GGTCGGGCGTGAAAACACTG41270622SRR21814500
479CCAATGTTTTTAAAACCGAC-GGTCGGGCGTGAAAACACTG59712788SRR21814500
480CCAATGTTTTTAAAACCGAC-TCGGGCGTGAAAACACTGCT124459727SRR21814492SRR21814493
480CCAATGTTTTTAAAACCGAC-TCGGGCGTGAAAACACTGCT411475735SRR21814492SRR21814493
481CCACACCGCGTTTGAGGGGG-TCCCCCTCAAACGCGGTGTG49078450SRR13608004
481CCACACCGCGTTTGAGGGGG-TCCCCCTCAAACGCGGTGTG49078458SRR13608004
482CCACACTTGGGTCCAGCATA-AATCTGCACCATATATGCTC113664923SRR13608004
482CCACACTTGGGTCCAGCATA-AATCTGCACCATATATGCTC25233866SRR13608004
483CCACCACCACCATACTATTC-ACCACCACCGTACGTCTACA18389674SRR13608004
483CCACCACCACCATACTATTC-ACCACCACCGTACGTCTACA310702667SRR13608004
484CCACCACCACCTGGGTTTAC-GCAATTTCAGGGGAACTACC114492223SRR13608004
484CCACCACCACCTGGGTTTAC-GCAATTTCAGGGGAACTACC511805108SRR21814503
485CCACTACAAGAAAACAGACA-ACGCCTGTTTTCTTGTAGTG113711520SRR21814499
485CCACTACAAGAAAACAGACA-ACGCCTGTTTTCTTGTAGTG315030753SRR21814499
486CCAGCGACAGCGACTAAAAG-CTTTTAGTCGCTGTCGCTGG114030840SRR13608004
486CCAGCGACAGCGACTAAAAG-CTTTTAGTCGCTGTCGCTGG114030848SRR13608004
487CCAGTGTTTTCACGCCCGAC-GGTCGGGTTTCAAAACATTG213539964SRR21814512
487CCAGTGTTTTCACGCCCGAC-GGTCGGGTTTCAAAACATTG318814713SRR21814515
487CCAGTGTTTTCACGCCCGAC-GGTCGGGTTTCAAAACATTG416241731SRR21814512
487CCAGTGTTTTCACGCCCGAC-GGTCGGGTTTCAAAACATTG517557007SRR21814515
488CCAGTGTTTTCACGCCCGAC-TCGGGTTTCAAAACATTGGT130180775SRR21814495
488CCAGTGTTTTCACGCCCGAC-TCGGGTTTCAAAACATTGGT517038931SRR21814495
489CCATAGAAACACTAACAAAT-TCAAATGCATTGGATTGTGA114935593SRR21814487
489CCATAGAAACACTAACAAAT-TCAAATGCATTGGATTGTGA114973789SRR21814487
490CCATATGTCTCATAATATCT-ATTGATGATTCTATGTGTTT310931654SRR13608004
490CCATATGTCTCATAATATCT-ATTGATGATTCTATGTGTTT43859669SRR13608004
491CCATCAAAGCTTTGAAAAGC-CCAAAGACTCATATGGACTT43969615SRR21814505
491CCATCAAAGCTTTGAAAAGC-CCAAAGACTCATATGGACTT44001400SRR21814505
491CCATCAAAGCTTTGAAAAGC-CCAAAGACTCATATGGACTT512048033SRR21814505
492CCATTTTTATTTATACCCTC-CTTTTCAATTCTACCCTTTT110527732SRR21814490
492CCATTTTTATTTATACCCTC-CTTTTCAATTCTACCCTTTT23194038SRR21814490
493CCCAAAAGAGGCTAAAACCA-GACAACACTTATACCAATTT114673692SRR13608004
493CCCAAAAGAGGCTAAAACCA-GACAACACTTATACCAATTT44066991SRR13608004
494CCCAAAAGCTAAAGTAATGT-TAGAAGAACTAGAACCGCAA42920480SRR13608004
494CCCAAAAGCTAAAGTAATGT-TAGAAGAACTAGAACCGCAA42921372SRR13608004
495CCCAAACTTTAAAACCAAAA-ACCTAAACCCTAAACCATAG115088131SRR21814505
495CCCAAACTTTAAAACCAAAA-ACCTAAACCCTAAACCATAG115110596SRR21814505
496CCCAATCTTAAAAGCCTAAG-GAGTATAAGAACTTAAACAG43970225SRR13608004
496CCCAATCTTAAAAGCCTAAG-GAGTATAAGAACTTAAACAG43983193SRR13608004
497CCCAATCTTAAAAGCCTAAG-TGAGTATAAGAACTTAAACA43970225SRR13608004
497CCCAATCTTAAAAGCCTAAG-TGAGTATAAGAACTTAAACA43971649SRR13608004
498CCCATTAAGAAATTCTCCCT-TGAGGGAGAATTTCTTAATG321799995SRR13608004
498CCCATTAAGAAATTCTCCCT-TGAGGGAGAATTTCTTAATG321800002SRR13608004
499CCCATTTGCTAGGTTATCTG-GGGATTCATATGGTTTAGTA23814415SRR13608004
499CCCATTTGCTAGGTTATCTG-GGGATTCATATGGTTTAGTA43674018SRR13608004
500CCCATTTGCTAGGTTATCTG-GTTCATATGGTTTAGTAGAT23958848SRR13608004
500CCCATTTGCTAGGTTATCTG-GTTCATATGGTTTAGTAGAT24462402SRR13608004
501CCCGAATAGGTATCCAAACA-TAAACTTCAAAACCCAAAAA111351607SRR21814496
501CCCGAATAGGTATCCAAACA-TAAACTTCAAAACCCAAAAA24085620SRR21814496
502CCCGACTCTTAGGATCGACT-TAGTCGATCCTAAGAGTCGG27688SRR13608004
502CCCGACTCTTAGGATCGACT-TAGTCGATCCTAAGAGTCGG27692SRR13608004
503CCCTAAACCCTAAACCCTAA-CCCTAAACCCTAAACCCTAA115421610SRR21814511
503CCCTAAACCCTAAACCCTAA-CCCTAAACCCTAAACCCTAA115424518SRR21814511
503CCCTAAACCCTAAACCCTAA-CCCTAAACCCTAAACCCTAA312276675SRR13608004
503CCCTAAACCCTAAACCCTAA-CCCTAAACCCTAAACCCTAA312277342SRR21814511
504CCCTAGAATTCTTTCCCTTT-AGATTTTTTCTAACTTCTTT113792848SRR21814510
504CCCTAGAATTCTTTCCCTTT-AGATTTTTTCTAACTTCTTT113941923SRR21814510
505CCGATCTTATAAGCCTAAGT-TTGAGTAAAAGAACTTAAAC313590184SRR21814490
505CCGATCTTATAAGCCTAAGT-TTGAGTAAAAGAACTTAAAC43979988SRR21814490
506CCGCAACCCTATCTTAAAAG-ATCATTGAGTATAAGAACTT43973435SRR13608004
506CCGCAACCCTATCTTAAAAG-ATCATTGAGTATAAGAACTT511651500SRR13608004
507CCGTCAGAGGAAAGGAATTG-TTGGTGCTGGAGATGCACCA114926039SRR13608004
507CCGTCAGAGGAAAGGAATTG-TTGGTGCTGGAGATGCACCA44763327SRR21814489
508CCTAAACCCTAAACCCTAAA-CCCTAAACCCTTAAACCTAA115200720SRR21814505
508CCTAAACCCTAAACCCTAAA-CCCTAAACCCTTAAACCTAA115232339SRR21814505
509CCTGGTCGACGATTTCAACC-CGACAAACCCTCGACCACTC21295SRR13608004
509CCTGGTCGACGATTTCAACC-CGACAAACCCTCGACCACTC314192226SRR21814486
510CCTTATTAGAAGAAACAAAG-AGCTTAAAAGCCTAAGTAGT511704761SRR13608004
510CCTTATTAGAAGAAACAAAG-AGCTTAAAAGCCTAAGTAGT511729884SRR13608004
511CCTTCTTCTAGCTTCTCAAA-TTCGACTCCAAAACACTAAC511705748SRR13608004
511CCTTCTTCTAGCTTCTCAAA-TTCGACTCCAAAACACTAAC511826018SRR13608004
512CCTTCTTGCTTCTCAAAGCT-ATTCGACTCCAAAACACTAA313589700SRR21814509
512CCTTCTTGCTTCTCAAAGCT-ATTCGACTCCAAAACACTAA511754228SRR13608004
513CCTTGTTAGAAGACACAAAG-CACGATCTTATAAGCCTAAG43027067SRR13608004
513CCTTGTTAGAAGACACAAAG-CACGATCTTATAAGCCTAAG44000023SRR21814507
514CCTTTAAAATCCCTTATAAA-ACCTTTGTAAATCTTTTAAA22065739SRR13608004
514CCTTTAAAATCCCTTATAAA-ACCTTTGTAAATCTTTTAAA516014791SRR21814516
515CGAAGTCAATATGAGTCTTT-TCTAAAAGCTTTCATGGTGT43041516SRR13608004
515CGAAGTCAATATGAGTCTTT-TCTAAAAGCTTTCATGGTGT43977073SRR13608004
516CGACCACTCCTCGGACACGG-GTCGACCAGGACGGCGGATC21029SRR13608004
516CGACCACTCCTCGGACACGG-GTCGACCAGGACGGCGGATC314191898SRR13608004
517CGACTTTGGCTACACCATGA-AACACAAAGCCAAAGACTCA115083369SRR13608004
517CGACTTTGGCTACACCATGA-AACACAAAGCCAAAGACTCA23663902SRR21814506
518CGAGTATCACTTCGCCACAC-GTGTGGCGAAGTGATACTCG43274797SRR13608004
518CGAGTATCACTTCGCCACAC-GTGTGGCGAAGTGATACTCG43274806SRR13608004
519CGATCTCTTATTTGAGAGAG-TTGTGGAATTCGACCCTTAA117407924SRR21814514
519CGATCTCTTATTTGAGAGAG-TTGTGGAATTCGACCCTTAA511288942SRR21814514
520CGATCTTGTAAGCCTAAGTA-TAAGTATAAGAACTTAAACC313586978SRR13608004
520CGATCTTGTAAGCCTAAGTA-TAAGTATAAGAACTTAAACC43975719SRR13608004
521CGATGAAAGCCTGGTGGATA-TTAGCTTGTTTGATGAGACC113516753SRR13608004
521CGATGAAAGCCTGGTGGATA-TTAGCTTGTTTGATGAGACC42999441SRR13608004
522CGCATGCAAGGGTTGCAGTG-CACTGCAACCCTTGCATGCG112720988SRR13608004
522CGCATGCAAGGGTTGCAGTG-CACTGCAACCCTTGCATGCG112720992SRR13608004
523CGCCAAAAACGTAAACCCGT-AAAATGTAAACCTGTAATTT110526639SRR21814503
523CGCCAAAAACGTAAACCCGT-AAAATGTAAACCTGTAATTT116613819SRR13608004
524CGCCAAAAACGTAAACCTGT-AAACGTAAATCCGTAATTTT110526639SRR21814515
524CGCCAAAAACGTAAACCTGT-AAACGTAAATCCGTAATTTT116395495SRR21814515
525CGCGCGTGCGGGCAAAATTC-TTTTCTTTTTCTTATTCTTA314194289SRR13608004
525CGCGCGTGCGGGCAAAATTC-TTTTCTTTTTCTTATTCTTA314194295SRR21814495
526CGGACTTTGGCTACACCATG-TTAGAAGATACAAAGCCAAA114510492SRR13608004
526CGGACTTTGGCTACACCATG-TTAGAAGATACAAAGCCAAA511787313SRR13608004
527CGGTTAAAGTTCTTATACTC-ACACTACTTAGGCTTACAAG115083661SRR21814513
527CGGTTAAAGTTCTTATACTC-ACACTACTTAGGCTTACAAG43967454SRR21814513
528CGGTTGCGGTTTAAGTTCTT-AAGGATACACTACTTAGGCT23606425SRR21814487
528CGGTTGCGGTTTAAGTTCTT-AAGGATACACTACTTAGGCT511788678SRR13608004
529CGGTTTAAATTCTTATACTC-ATTCTTATGCCTTTAAGATC23615625SRR21814503
529CGGTTTAAATTCTTATACTC-ATTCTTATGCCTTTAAGATC511671070SRR21814503
529CGGTTTAAATTCTTATACTC-ATTCTTATGCCTTTAAGATC511701621SRR21814503
530CGTAGTAGTATTTAATTGTA-CCGTCAATTCTAGGATTTCA116803874SRR21814490
530CGTAGTAGTATTTAATTGTA-CCGTCAATTCTAGGATTTCA116966315SRR21814490
531CGTATTTACCTTTACCTCAG-CTGAGGTAAAGGTAAATACG24248701SRR13608004
531CGTATTTACCTTTACCTCAG-CTGAGGTAAAGGTAAATACG24248710SRR13608004
532CGTCACTAGTCCAGCTACCT-CTCGTCCAGCTACCTCGAGC22563847SRR13608004
532CGTCACTAGTCCAGCTACCT-CTCGTCCAGCTACCTCGAGC312034166SRR21814515
533CGTCCTCTCTCCCGTTCCTC-AGGAACGGGAGAGAGGACGG115293842SRR13608004
533CGTCCTCTCTCCCGTTCCTC-AGGAACGGGAGAGAGGACGG115293850SRR13608004
534CTAAACCATCAAAGCTTTGA-ACAAAGACAAAGACTCATAT42968229SRR21814505
534CTAAACCATCAAAGCTTTGA-ACAAAGACAAAGACTCATAT44000871SRR13608004
535CTAAACCCTAACTCTAAACC-CCTAAACCCTAAACCCTAAA115096974SRR21814491SRR21814496SRR21814509
535CTAAACCCTAACTCTAAACC-CCTAAACCCTAAACCCTAAA115291319SRR21814491SRR21814496SRR21814509
536CTAAACCTTAAAACCTAAAA-TCTAAACCCTAAACCGTACG115089650SRR21814507
536CTAAACCTTAAAACCTAAAA-TCTAAACCCTAAACCGTACG115198998SRR21814507
537CTAAACTCATTTAATTATGA-TCAACCCATAACTTATTTAA110527085SRR21814486SRR21814497SRR21814508
537CTAAACTCATTTAATTATGA-TCAACCCATAACTTATTTAA110527156SRR21814486SRR21814497SRR21814508
538CTAAACTTTAAACCCTAAAC-CCCTAAAATCTAATCCCTAA115089650SRR21814509
538CTAAACTTTAAACCCTAAAC-CCCTAAAATCTAATCCCTAA115145891SRR21814509
539CTAACTGCTTCAGTTTCATC-GATGAAACTGAAGCAGTTAG4141932SRR13608004
539CTAACTGCTTCAGTTTCATC-GATGAAACTGAAGCAGTTAG4141941SRR13608004
540CTAATAATGCAAATAGGGAA-ATATAGACCCTAAAAACGTC510889211SRR21814500
540CTAATAATGCAAATAGGGAA-ATATAGACCCTAAAAACGTC512095855SRR21814500
541CTAGTGATAACATCAGAAGT-GCACTTCTGATGTTATCACT310627372SRR13608004
541CTAGTGATAACATCAGAAGT-GCACTTCTGATGTTATCACT310627376SRR13608004
542CTCAAAACCAAATATCAATA-ATATTGATTTCCTGAAAAAA115415923SRR21814508
542CTCAAAACCAAATATCAATA-ATATTGATTTCCTGAAAAAA43280477SRR21814508
543CTCAATCGGATGGCAATTAC-TGGGAGCTAGTTGAAAACTT23921346SRR21814492
543CTCAATCGGATGGCAATTAC-TGGGAGCTAGTTGAAAACTT511570227SRR21814492
544CTCATATTTCACTCTGAAAT-CTCAATCATACACATGAAAT114510063SRR13608004
544CTCATATTTCACTCTGAAAT-CTCAATCATACACATGAAAT43043291SRR13608004
545CTCCAAAACACTAACCAAAG-TACACATGACATTAAGTCAT511664702SRR21814509
545CTCCAAAACACTAACCAAAG-TACACATGACATTAAGTCAT511731581SRR21814509
546CTCGATCACTTCACTCGACC-CCACCTGGCCGAGTACCACC41811638SRR21814488
546CTCGATCACTTCACTCGACC-CCACCTGGCCGAGTACCACC512639936SRR13608004
547CTCTCTCTCTCTCTCTCACT-CACTCTCTCTCTCTCTCTCT416434348SRR21814503
547CTCTCTCTCTCTCTCTCACT-CACTCTCTCTCTCTCTCTCT5416985SRR21814503
548CTCTCTCTCTCTCTCTCTCC-CTCTCCCTCTCTCTCTCTCT15065123SRR21814514
548CTCTCTCTCTCTCTCTCTCC-CTCTCCCTCTCTCTCTCTCT318218444SRR21814514
549CTCTCTCTCTCTCTCTCTCT-TCTCTCTCTCTCTTCTCTCT113085463SRR21814510
549CTCTCTCTCTCTCTCTCTCT-TCTCTCTCTCTCTTCTCTCT116165769SRR13608004
549CTCTCTCTCTCTCTCTCTCT-TCTCTCTCTCTCTTCTCTCT210660571SRR21814510
550CTCTTATAATTAATCAAATG-CCTAAACACTCCTAATCCAT114609774SRR21814495
550CTCTTATAATTAATCAAATG-CCTAAACACTCCTAATCCAT114932065SRR21814495
551CTCTTATAATTAGTCAAAAG-CCTAAACACTCCTAATCCAT114609774SRR21814492SRR21814494
551CTCTTATAATTAGTCAAAAG-CCTAAACACTCCTAATCCAT114932065SRR21814492SRR21814494
552CTCTTGACTTACTCTTCTCA-AGTGAGAAGAGTAAGTCAAG314193353SRR13608004
552CTCTTGACTTACTCTTCTCA-AGTGAGAAGAGTAAGTCAAG314193359SRR13608004
553CTGAAGTCGATGCAACAAAC-GTTTGTTGCATCGACTTCAG417129137SRR13608004
553CTGAAGTCGATGCAACAAAC-GTTTGTTGCATCGACTTCAG417129144SRR13608004
554CTGATAAGTGTGTATTTTGC-ACTTAAAAACCTATTATCAA510761335SRR21814505
554CTGATAAGTGTGTATTTTGC-ACTTAAAAACCTATTATCAA511731351SRR13608004
555CTGCAAAAATGTATATATAG-CCAGGATTTATTTCACAAAA22299089SRR13608004
555CTGCAAAAATGTATATATAG-CCAGGATTTATTTCACAAAA210997021SRR21814517
556CTGTAACGCCCGCGATCCTC-GTCCGGATCGGGGCCTTTCA26469SRR21814488
556CTGTAACGCCCGCGATCCTC-GTCCGGATCGGGGCCTTTCA27310SRR21814488
556CTGTAACGCCCGCGATCCTC-GTCCGGATCGGGGCCTTTCA25398838SRR21814488
557CTGTTTTGCTAGTCAACTAC-TGTAGTTGACTAGCAAAACA511292050SRR13608004
557CTGTTTTGCTAGTCAACTAC-TGTAGTTGACTAGCAAAACA511292055SRR13608004
558CTTAAAAGCCTAAGTAGTGT-AGTATAACAACTTAAACCGC43977494SRR21814497
558CTTAAAAGCCTAAGTAGTGT-AGTATAACAACTTAAACCGC511683631SRR13608004
559CTTAAAAGCCTAAGTAGTGT-TAAGAACCTAAACCGCAACC23620135SRR21814494
559CTTAAAAGCCTAAGTAGTGT-TAAGAACCTAAACCGCAACC511790810SRR13608004
560CTTAAACAGCAACCCGATCT-GTCATGTGTATGATTGAGTA23714154SRR21814500
560CTTAAACAGCAACCCGATCT-GTCATGTGTATGATTGAGTA511683649SRR13608004
561CTTAAGGGTCGAATTCCACA-ACTCTCTCAAATAAGAGATC117407932SRR21814488SRR21814491SRR21814496SRR21814499SRR21814504SRR21814506SRR21814516SRR21814518SRR21814519
561CTTAAGGGTCGAATTCCACA-ACTCTCTCAAATAAGAGATC511288950SRR21814488SRR21814491SRR21814496SRR21814499SRR21814504SRR21814506SRR21814516SRR21814518SRR21814519
562CTTACTCGACCACACCCAGT-ACTGGGTGTGGTCGAGTAAG511490070SRR13608004
562CTTACTCGACCACACCCAGT-ACTGGGTGTGGTCGAGTAAG511490077SRR13608004
563CTTAGAGAAGCAAGAAGAAG-GGACTTTGGCTACACCATGA115088450SRR13608004
563CTTAGAGAAGCAAGAAGAAG-GGACTTTGGCTACACCATGA23620569SRR13608004
564CTTAGGCTTACAAGATCGGG-TTGTATCTTCTAACAAGGAT43041744SRR13608004
564CTTAGGCTTACAAGATCGGG-TTGTATCTTCTAACAAGGAT511823622SRR21814505
564CTTAGGCTTACAAGATCGGG-TTGTATCTTCTAACAAGGAT511894382SRR21814505
565CTTAGGCTTATAAGATCGGG-TTGTGTCTTCTAACAAGGAA511822150SRR13608004
565CTTAGGCTTATAAGATCGGG-TTGTGTCTTCTAACAAGGAA511894382SRR13608004
565CTTAGGCTTATAAGATCGGG-TTGTGTCTTCTAACAAGGAA511965282SRR13608004
566CTTATAAGCAAGTTTTGTTG-ACACTAACAAATCTATTTAC114934674SRR13608004
566CTTATAAGCAAGTTTTGTTG-ACACTAACAAATCTATTTAC114936258SRR13608004
567CTTATAATATTTTTTCATGT-AATTTTCTTAAATCTATTTT111700206SRR21814517
567CTTATAATATTTTTTCATGT-AATTTTCTTAAATCTATTTT112855602SRR21814517
568CTTATTTACAATGGTTGCCA-TGAAATAAATCCTGGAGTTG110021910SRR21814517
568CTTATTTACAATGGTTGCCA-TGAAATAAATCCTGGAGTTG38772199SRR21814517
569CTTCACAAAACTAGATTTTA-AGTGAAATCTAAGTGTTGAG23609178SRR21814503
569CTTCACAAAACTAGATTTTA-AGTGAAATCTAAGTGTTGAG23609372SRR13608004
570CTTCACCATCAAAGCTTTAA-CCAAAAACTCATAAGAATTT115089844SRR21814515
570CTTCACCATCAAAGCTTTAA-CCAAAAACTCATAAGAATTT115149240SRR21814515
571CTTCAGATTGACAGAATTGC-GCAATTCTGTCAATCTGAAG54577169SRR13608004
571CTTCAGATTGACAGAATTGC-GCAATTCTGTCAATCTGAAG54577177SRR13608004
572CTTCTAAACAATATTTTGTT-AACACTAACAAAGATATTTA114671034SRR21814512
572CTTCTAAACAATATTTTGTT-AACACTAACAAAGATATTTA114952324SRR13608004
573CTTCTAACAAGAAAACACTA-CAAAGTCCATATGAGTCTTT43976035SRR21814513
573CTTCTAACAAGAAAACACTA-CAAAGTCCATATGAGTCTTT44000367SRR21814513
574CTTCTCAAAGCTTTAATGGT-CAAAACACTAACCAACCGTC23660842SRR13608004
574CTTCTCAAAGCTTTAATGGT-CAAAACACTAACCAACCGTC511790012SRR13608004
575CTTCTTCTAGCTTCTCAAAG-CATATTCGACTCCAAAACAC42967554SRR21814491
575CTTCTTCTAGCTTCTCAAAG-CATATTCGACTCCAAAACAC511705038SRR13608004
576CTTCTTCTTGCTTCTCAAAG-ATTCGACTCCAAAACATTAA42977033SRR21814505
576CTTCTTCTTGCTTCTCAAAG-ATTCGACTCCAAAACATTAA43045810SRR21814505
577CTTCTTGCTTCTCAAAGCTT-ATTTGACTCCAAAACACTAA23606327SRR13608004
577CTTCTTGCTTCTCAAAGCTT-ATTTGACTCCAAAACACTAA43030030SRR21814496
578CTTGACTTACTCTTCTCACT-AGTGAGAAGAGTAAGTCAAG314193351SRR13608004
578CTTGACTTACTCTTCTCACT-AGTGAGAAGAGTAAGTCAAG314193355SRR13608004
578CTTGACTTACTCTTCTCACT-AGTGAGAAGAGTAAGTCAAG314193361SRR13608004
579CTTGAGGTCACTTGCATCTC-GAGATGCAAGTGACCTCAAG512751461SRR13608004
579CTTGAGGTCACTTGCATCTC-GAGATGCAAGTGACCTCAAG512751465SRR13608004
580CTTGATGCTGGTGTCATTTA-TGTAAAAAGAAATTTTGAAA114231564SRR21814510
580CTTGATGCTGGTGTCATTTA-TGTAAAAAGAAATTTTGAAA44412255SRR21814510
581CTTGATTAGTGTTTTGGAGT-CAAAGCTTTGACAAGCAAGA44001015SRR13608004
581CTTGATTAGTGTTTTGGAGT-CAAAGCTTTGACAAGCAAGA511680226SRR21814492
582CTTGCGGTTTAAGTTCTTAT-TACAATTCTTACGCCTTTAA44003428SRR21814505
582CTTGCGGTTTAAGTTCTTAT-TACAATTCTTACGCCTTTAA512050971SRR21814505
583CTTGCTTCTAAAAGCTTTGA-AAAAACACTAACCAAACTTC114498869SRR13608004
583CTTGCTTCTAAAAGCTTTGA-AAAAACACTAACCAAACTTC43034661SRR13608004
584CTTGCTTCTCAAAGCTTTGA-CGACTCCAAAACACTAATCA114510098SRR21814499
584CTTGCTTCTCAAAGCTTTGA-CGACTCCAAAACACTAATCA313590995SRR21814499
585CTTGGTTAGTGTTTTGGAGT-ACCATCAAAGCTTTGAGAAG114509917SRR21814492
585CTTGGTTAGTGTTTTGGAGT-ACCATCAAAGCTTTGAGAAG511670959SRR21814492
586CTTGTTAGAACACACAAAGC-TCCTAAAAGCCTAAGTAGTG511729885SRR21814502
586CTTGTTAGAACACACAAAGC-TCCTAAAAGCCTAAGTAGTG512048334SRR21814502
587CTTGTTAGAAGATACAAAGC-TCCTAAAAGCCTAAGTAGTG43026891SRR13608004
587CTTGTTAGAAGATACAAAGC-TCCTAAAAGCCTAAGTAGTG43028340SRR13608004
588CTTGTTAGTGTTTTGGAGTC-ACATGAAAGCTTTGAGAAGC115437522SRR13608004
588CTTGTTAGTGTTTTGGAGTC-ACATGAAAGCTTTGAGAAGC43951192SRR13608004
589CTTGTTGAACAACCCCCGAT-ATCGGGGGTTGTTCAACAAG37750135SRR13608004
589CTTGTTGAACAACCCCCGAT-ATCGGGGGTTGTTCAACAAG37750141SRR13608004
590CTTTACCATCAAAGCTTTGA-AAAAAACTCATAAGAACTTC115092855SRR13608004
590CTTTACCATCAAAGCTTTGA-AAAAAACTCATAAGAACTTC115149240SRR21814495SRR21814497
591CTTTGTATCTTCTAACAAGG-CCAAAGTCCATATGAGTCTT43029798SRR13608004
591CTTTGTATCTTCTAACAAGG-CCAAAGTCCATATGAGTCTT511669071SRR13608004
592CTTTGTATCTTCTAACAAGG-TAACCAAAGTCCGTATGAGT313669758SRR13608004
592CTTTGTATCTTCTAACAAGG-TAACCAAAGTCCGTATGAGT512025908SRR13608004
593CTTTGTATCTTCTAACAATG-ACAAAGTCCATATGAGTCTT23615330SRR13608004
593CTTTGTATCTTCTAACAATG-ACAAAGTCCATATGAGTCTT43034432SRR13608004
594CTTTTAAAATCCCTTGTAAA-AAATCTCTTGTAAATCTTTT116597249SRR21814508
594CTTTTAAAATCCCTTGTAAA-AAATCTCTTGTAAATCTTTT313341752SRR21814508
595GAAAAATCACGGGTTTACGT-TCACGGGTTTACGTTTTTGG110526890SRR21814499
595GAAAAATCACGGGTTTACGT-TCACGGGTTTACGTTTTTGG116259410SRR13608004
596GAAAATCCCGGCGGCCGGAC-GTCCGGCCGCCGGGATTTTC22020SRR21814500
596GAAAATCCCGGCGGCCGGAC-GTCCGGCCGCCGGGATTTTC22023SRR21814500
597GAAAATCCTAGAATTGACTG-TTATTCAATTTTTAATACAA116326127SRR13608004
597GAAAATCCTAGAATTGACTG-TTATTCAATTTTTAATACAA2500653SRR13608004
598GAAACAACCCGACCCATTTT-TTTCCGGTTCACGGGCGTTA113415256SRR21814504
598GAAACAACCCGACCCATTTT-TTTCCGGTTCACGGGCGTTA123197643SRR21814504
599GAAACACTACTTAGGCTTTT-TATCTTTGTATCTTCTAACA512028889SRR13608004
599GAAACACTACTTAGGCTTTT-TATCTTTGTATCTTCTAACA512058458SRR13608004
600GAAATACAAGATTGGTTTTG-CAAAACCAATCTTGTATTTC113526660SRR21814496
600GAAATACAAGATTGGTTTTG-CAAAACCAATCTTGTATTTC113526665SRR21814496
601GAAATTCAGGAAGAATGGGA-TCCCATTCTTCCTGAATTTC44154417SRR21814507
601GAAATTCAGGAAGAATGGGA-TCCCATTCTTCCTGAATTTC44154425SRR21814507
602GAACATGGCGGTTCGTCTAT-GTACCCACATGCTGGAGCTG511403958SRR13608004
602GAACATGGCGGTTCGTCTAT-GTACCCACATGCTGGAGCTG512472452SRR13608004
603GAACCAACGGATGTTAGTAC-GTACTAACATCCGTTGGTTC315541158SRR13608004
603GAACCAACGGATGTTAGTAC-GTACTAACATCCGTTGGTTC315541166SRR13608004
604GAACTTTTAAATTTGGGACG-GAAAAAATGTCAAAAAAATC2176803SRR21814510SRR21814511
604GAACTTTTAAATTTGGGACG-GAAAAAATGTCAAAAAAATC211267241SRR21814510SRR21814511
605GAACTTTTATCACTTATGCC-GGCATAAGAGGTGAGCTCTCVANDAL6 DNA/MuDR111959299SRR21814500SRR21814501
605GAACTTTTATCACTTATGCC-GGCATAAGAGGTGAGCTCTCVANDAL6 DNA/MuDR25627731SRR21814492SRR21814493SRR21814495SRR21814512SRR21814513
605GAACTTTTATCACTTATGCC-GGCATAAGAGGTGAGCTCTCVANDAL6 DNA/MuDR33111725SRR21814510
605GAACTTTTATCACTTATGCC-GGCATAAGAGGTGAGCTCTCVANDAL6 DNA/MuDR36823494SRR21814518
605GAACTTTTATCACTTATGCC-GGCATAAGAGGTGAGCTCTCVANDAL6 DNA/MuDR37092813SRR21814518
605GAACTTTTATCACTTATGCC-GGCATAAGAGGTGAGCTCTCVANDAL6 DNA/MuDR312150313SRR21814493SRR21814495SRR21814498SRR21814500SRR21814501SRR21814502SRR21814510SRR21814513
605GAACTTTTATCACTTATGCC-GGCATAAGAGGTGAGCTCTCVANDAL6 DNA/MuDR322028072SRR21814495SRR21814502
605GAACTTTTATCACTTATGCC-GGCATAAGAGGTGAGCTCTCVANDAL6 DNA/MuDR42563045SRR21814495
605GAACTTTTATCACTTATGCC-GGCATAAGAGGTGAGCTCTCVANDAL6 DNA/MuDR46352915SRR21814504
605GAACTTTTATCACTTATGCC-GGCATAAGAGGTGAGCTCTCVANDAL6 DNA/MuDR48845864SRR21814504
605GAACTTTTATCACTTATGCC-GGCATAAGAGGTGAGCTCTCVANDAL6 DNA/MuDR53472155SRR21814498
605GAACTTTTATCACTTATGCC-GGCATAAGAGGTGAGCTCTCVANDAL6 DNA/MuDR57340023SRR21814501SRR21814512SRR21814520
605GAACTTTTATCACTTATGCC-GGCATAAGAGGTGAGCTCTCVANDAL6 DNA/MuDR510149271SRR21814520
605GAACTTTTATCACTTATGCC-GGCATAAGAGGTGAGCTCTCVANDAL6 DNA/MuDR515901672SRR21814492SRR21814493SRR21814512
606GAAGAAGAAGAAGAAGATCG-GAAGAAGATCGATTGATCTT113738061SRR21814510
606GAAGAAGAAGAAGAAGATCG-GAAGAAGATCGATTGATCTT319039817SRR21814510
607GAAGAAGCTTGGTTAGTGTT-CACAATCAAAGCTTTGAGAA115167270SRR13608004
607GAAGAAGCTTGGTTAGTGTT-CACAATCAAAGCTTTGAGAA115437692SRR13608004
607GAAGAAGCTTGGTTAGTGTT-CACAATCAAAGCTTTGAGAA511958507SRR13608004
608GAAGACACAAAGCCAAAGAC-ACTAAGTAGTGTTTCCTTGT114484317SRR13608004
608GAAGACACAAAGCCAAAGAC-ACTAAGTAGTGTTTCCTTGT511670851SRR13608004
608GAAGACACAAAGCCAAAGAC-ACTAAGTAGTGTTTCCTTGT511974794SRR13608004
609GAAGACACAAAGCCAAAGAC-GACTAAGTAGTGTTTCCTTG511660314SRR13608004
609GAAGACACAAAGCCAAAGAC-GACTAAGTAGTGTTTCCTTG511753982SRR13608004
609GAAGACACAAAGCCAAAGAC-GACTAAGTAGTGTTTCCTTG511974794SRR13608004
610GAAGCAATAAGAAGCTTGGT-GACTTCGGCTACACCATCAA42967006SRR21814502
610GAAGCAATAAGAAGCTTGGT-GACTTCGGCTACACCATCAA43042268SRR21814502
611GAAGCAGTAAATAGCTTTGG-AAAGGCTAAAACCAACAAAA114681303SRR21814501
611GAAGCAGTAAATAGCTTTGG-AAAGGCTAAAACCAACAAAA115017705SRR13608004
612GAAGCCTAAAGTAGGATTTA-CTAGAACAGCAACCGGATTC115096484SRR13608004
612GAAGCCTAAAGTAGGATTTA-CTAGAACAGCAACCGGATTC115245153SRR13608004
613GAAGCGGACCTGATCATGAC-TTTAGAGCTGTTGACGAGCT315250661SRR21814506
613GAAGCGGACCTGATCATGAC-TTTAGAGCTGTTGACGAGCT44780602SRR21814506
614GAAGCTTGGTTAGTGTTTTG-AACCATCAAAGCTTTGAGAA114509921SRR21814492
614GAAGCTTGGTTAGTGTTTTG-AACCATCAAAGCTTTGAGAA512054797SRR13608004
615GAAGCTTTGTTAGTGTTTTG-CCATCAAAGCTTTGAGAAGC115747695SRR21814493
615GAAGCTTTGTTAGTGTTTTG-CCATCAAAGCTTTGAGAAGC43976331SRR13608004
616GAAGTACGTATGAGTCTTTG-TTCTCAAAGCTTTGATAGTG117490731SRR13608004
616GAAGTACGTATGAGTCTTTG-TTCTCAAAGCTTTGATAGTG23661046SRR13608004
617GAAGTCAATATGAGTCTTTG-CTAAAAGCTTTCATGGTGTA43041517SRR13608004
617GAAGTCAATATGAGTCTTTG-CTAAAAGCTTTCATGGTGTA43977074SRR13608004
618GAAGTCCGTATGAGTCTTTG-CTTCTAAAAGCTTTGATGGT42921080SRR13608004
618GAAGTCCGTATGAGTCTTTG-CTTCTAAAAGCTTTGATGGT43043356SRR21814486
619GAATAATCGTCTGGCCAGTC-GACACAAGAGATGATCCCTC17946745SRR21814496
619GAATAATCGTCTGGCCAGTC-GACACAAGAGATGATCCCTC218752864SRR21814489SRR21814496SRR21814506
619GAATAATCGTCTGGCCAGTC-GACACAAGAGATGATCCCTC515708706SRR21814489SRR21814496SRR21814506SRR21814509
619GAATAATCGTCTGGCCAGTC-GACACAAGAGATGATCCCTC526791263SRR21814509
620GAATCTTAAAGGCGTAAGAA-GTATAACAACTTAAACCGCA23621020SRR21814510
620GAATCTTAAAGGCGTAAGAA-GTATAACAACTTAAACCGCA23622087SRR21814510
621GAATGCATATTTAGGTTGAT-ATCAACCTAAATATGCATTC23977628SRR13608004
621GAATGCATATTTAGGTTGAT-ATCAACCTAAATATGCATTC23977632SRR13608004
622GAATTAACCAGACAAATCGC-GCGATTTGTCTGGTTAATTC314198998SRR13608004
622GAATTAACCAGACAAATCGC-GCGATTTGTCTGGTTAATTC314199004SRR13608004
623GACAAATCCTCGACCACTCC-ATCCTCGACCACTCCTCGGC21122SRR13608004
623GACAAATCCTCGACCACTCC-ATCCTCGACCACTCCTCGGC21136SRR21814511
624GACAACAATGGAGATAAGGA-CTTTTCAGGTATTCTATGCA114207264SRR21814503
624GACAACAATGGAGATAAGGA-CTTTTCAGGTATTCTATGCA25727292SRR13608004
625GACATCTCGGTATTTCGTGC-CGCACGAAATACCGAGATGT22316SRR13608004
625GACATCTCGGTATTTCGTGC-CGCACGAAATACCGAGATGT22321SRR13608004
626GACATTGATTTCATCTGGTC-CGATCTTGCAGCTTAGAACT113776296SRR21814499
626GACATTGATTTCATCTGGTC-CGATCTTGCAGCTTAGAACT115537948SRR13608004
627GACCAAGCCCTTTACACGTA-TTACGTGTAAAGGGCTTGGT114325040SRR13608004
627GACCAAGCCCTTTACACGTA-TTACGTGTAAAGGGCTTGGT114325047SRR13608004
628GACCAAGCCCTTTACACGTA-TTTACGTGTAAAGGGCTTGG114325040SRR13608004
628GACCAAGCCCTTTACACGTA-TTTACGTGTAAAGGGCTTGG114325047SRR13608004
629GACGGTGATGACTTTTGTCG-GCGACAAAAGTCATCACCGT26997091SRR13608004
629GACGGTGATGACTTTTGTCG-GCGACAAAAGTCATCACCGT26997096SRR13608004
630GACGTCCGGCGACGTTGTAC-AGTACAACGTCGCCGGACGT113974002SRR13608004
630GACGTCCGGCGACGTTGTAC-AGTACAACGTCGCCGGACGT113974003SRR13608004
631GACTATGAGAAGGAACCAAA-TCCCTGCTGATTTCGTGGTC512792267SRR13608004
631GACTATGAGAAGGAACCAAA-TCCCTGCTGATTTCGTGGTC512939181SRR13608004
632GACTCCCATCAAAAGATGGT-ACCCTTGGCCGGCTATCGAA23030SRR21814515
632GACTCCCATCAAAAGATGGT-ACCCTTGGCCGGCTATCGAA23045SRR13608004
633GACTTCGGCTACACCATCAA-AACAAAGCCAAAGACTCATA23602816SRR21814505
633GACTTCGGCTACACCATCAA-AACAAAGCCAAAGACTCATA511706147SRR21814505
634GACTTTGGCTAAACCATCAA-TACAAATACAAAGACTCATA44000167SRR21814490
634GACTTTGGCTAAACCATCAA-TACAAATACAAAGACTCATA512043477SRR13608004
635GACTTTGGCTACACCATGAA-AAACAAAGCCAAAGACTCAT114499080SRR13608004
635GACTTTGGCTACACCATGAA-AAACAAAGCCAAAGACTCAT511274849SRR21814491
636GAGAAGCAAGAAGAAGCTTG-TTCGACTACACCATCAAAGC511824580SRR13608004
636GAGAAGCAAGAAGAAGCTTG-TTCGACTACACCATCAAAGC511852716SRR13608004
637GAGAAGCAAGAAGAAGCTTT-AACTTTGGCTACACCATGAA43983104SRR13608004
637GAGAAGCAAGAAGAAGCTTT-AACTTTGGCTACACCATGAA511754747SRR13608004
638GAGAATATGCACTAGATGAC-TTAGTTTCTAATATTACCCT210729878SRR21814519
638GAGAATATGCACTAGATGAC-TTAGTTTCTAATATTACCCT47926609SRR21814519
639GAGAATATTACACGTAGAGG-CTAAACGTGTCACATTCCCT17284404SRR21814493
639GAGAATATTACACGTAGAGG-CTAAACGTGTCACATTCCCT129999910SRR21814501
639GAGAATATTACACGTAGAGG-CTAAACGTGTCACATTCCCT213066467SRR13608004
639GAGAATATTACACGTAGAGG-CTAAACGTGTCACATTCCCT37821542SRR21814508
639GAGAATATTACACGTAGAGG-CTAAACGTGTCACATTCCCT417352297SRR21814501SRR21814515
639GAGAATATTACACGTAGAGG-CTAAACGTGTCACATTCCCT517916316SRR21814504
640GAGAATATTACACGTAGAGG-TAAACGTGTCACATTCCCTA129999910SRR21814487SRR21814488
640GAGAATATTACACGTAGAGG-TAAACGTGTCACATTCCCTA213066467SRR13608004
641GAGAATATTACACTCTAAGA-CCTAAACGTGTCACATTCCC118768731SRR21814490
641GAGAATATTACACTCTAAGA-CCTAAACGTGTCACATTCCC25057813SRR21814513
641GAGAATATTACACTCTAAGA-CCTAAACGTGTCACATTCCC35710847SRR21814490SRR21814495SRR21814507SRR21814511SRR21814513SRR21814514SRR21814516SRR21814518
641GAGAATATTACACTCTAAGA-CCTAAACGTGTCACATTCCC35710857SRR21814495
641GAGAATATTACACTCTAAGA-CCTAAACGTGTCACATTCCC411839698SRR21814511
641GAGAATATTACACTCTAAGA-CCTAAACGTGTCACATTCCC511018952SRR21814495SRR21814507SRR21814513SRR21814514SRR21814516SRR21814518
642GAGAATGCTTGGGGTTACAC-ATAGACTTGTTCAAAAAGAA314193543SRR21814506
642GAGAATGCTTGGGGTTACAC-ATAGACTTGTTCAAAAAGAA516863236SRR13608004
643GAGAGCTCACCTCTTATGCC-GGCATAAGTGATAAAAGTTC25627739SRR21814492SRR21814493SRR21814495SRR21814512SRR21814513
643GAGAGCTCACCTCTTATGCC-GGCATAAGTGATAAAAGTTC33111717SRR21814510
643GAGAGCTCACCTCTTATGCC-GGCATAAGTGATAAAAGTTC36823487SRR21814518
643GAGAGCTCACCTCTTATGCC-GGCATAAGTGATAAAAGTTC37092806SRR21814518
643GAGAGCTCACCTCTTATGCC-GGCATAAGTGATAAAAGTTC312150305SRR21814493SRR21814495SRR21814505SRR21814506SRR21814510SRR21814513
643GAGAGCTCACCTCTTATGCC-GGCATAAGTGATAAAAGTTC322028064SRR21814495
643GAGAGCTCACCTCTTATGCC-GGCATAAGTGATAAAAGTTC42563037SRR21814495
643GAGAGCTCACCTCTTATGCC-GGCATAAGTGATAAAAGTTC46352907SRR21814504
643GAGAGCTCACCTCTTATGCC-GGCATAAGTGATAAAAGTTC48845872SRR21814504
643GAGAGCTCACCTCTTATGCC-GGCATAAGTGATAAAAGTTC411035858SRR21814505SRR21814506
643GAGAGCTCACCTCTTATGCC-GGCATAAGTGATAAAAGTTC57340031SRR21814512SRR21814520
643GAGAGCTCACCTCTTATGCC-GGCATAAGTGATAAAAGTTC510149263SRR21814520
643GAGAGCTCACCTCTTATGCC-GGCATAAGTGATAAAAGTTC515901664SRR21814492SRR21814493SRR21814512
644GAGATAAGTTGAGAACTAGG-CCTACTTTTACAATAAACCCVANDAL22 DNA/MuDR316706235SRR21814496
644GAGATAAGTTGAGAACTAGG-CCTACTTTTACAATAAACCCVANDAL22 DNA/MuDR47146582SRR21814496
645GAGATAAGTTGGAAAGTAGA-TCTATTTTGCCAATAAGCCC214451168SRR21814510
645GAGATAAGTTGGAAAGTAGA-TCTATTTTGCCAATAAGCCC524323254SRR21814510
646GAGATTGTCACGGATAACGG-CCGTTATCCGTGACAATCTC112669104SRR13608004
646GAGATTGTCACGGATAACGG-CCGTTATCCGTGACAATCTC112669108SRR13608004
647GAGCCCAGTAAGCTCCATGG-CCATGGAGCTTACTGGGCTC112827655SRR13608004
647GAGCCCAGTAAGCTCCATGG-CCATGGAGCTTACTGGGCTC112827662SRR13608004
648GAGGGAGTTTCAGTAGATCC-TTCTGGGTCACATTGTTTTT24562088SRR13608004
648GAGGGAGTTTCAGTAGATCC-TTCTGGGTCACATTGTTTTT45024000SRR21814510
649GAGGGATCATCTCTTGTGTC-GACTGGCCAGACGATTATTCVANDAL21 DNA/MuDR17946753SRR21814496
649GAGGGATCATCTCTTGTGTC-GACTGGCCAGACGATTATTCVANDAL21 DNA/MuDR218752856SRR21814489SRR21814496SRR21814506
649GAGGGATCATCTCTTGTGTC-GACTGGCCAGACGATTATTCVANDAL21 DNA/MuDR515708714SRR21814489SRR21814496SRR21814506SRR21814509
649GAGGGATCATCTCTTGTGTC-GACTGGCCAGACGATTATTCVANDAL21 DNA/MuDR526791271SRR21814509
650GAGTAGAAGAACTTAAACCG-TATGACTTGATGTAATGTGT511737090SRR13608004
650GAGTAGAAGAACTTAAACCG-TATGACTTGATGTAATGTGT511957036SRR13608004
651GAGTATAAGAACTTAAACCG-TATGACTTGATCTCATGTGT511726987SRR13608004
651GAGTATAAGAACTTAAACCG-TATGACTTGATCTCATGTGT512028659SRR13608004
652GAGTCTTTGCCTTTGTGTCT-CACGGTGTAGCCAAAGTCCA115083366SRR13608004
652GAGTCTTTGCCTTTGTGTCT-CACGGTGTAGCCAAAGTCCA115085838SRR13608004
653GAGTGAAATATGAATAGATG-CAAAAAGAATCTTGGTTAGC115087659SRR21814518
653GAGTGAAATATGAATAGATG-CAAAAAGAATCTTGGTTAGC115100208SRR21814518
654GAGTGATGTGATCGAGTGAT-CATCACTCGATCACATCACT115545835SRR13608004
654GAGTGATGTGATCGAGTGAT-CATCACTCGATCACATCACT115545843SRR13608004
655GAGTGTGTAATATTTTATGA-TTCATAAAATATTACACACT311043894SRR13608004
655GAGTGTGTAATATTTTATGA-TTCATAAAATATTACACACT311043900SRR13608004
656GAGTGTTTAGACAACACTTA-TATAAGAGTTAGAAATGGAT114657737SRR13608004
656GAGTGTTTAGACAACACTTA-TATAAGAGTTAGAAATGGAT114942502SRR21814497
656GAGTGTTTAGACAACACTTA-TATAAGAGTTAGAAATGGAT114951922SRR21814497SRR21814512
657GAGTTACCAACCTTAACAGA-GACCACAAAATCAGCAGGGA113518227SRR21814489SRR21814496
657GAGTTACCAACCTTAACAGA-GACCACAAAATCAGCAGGGA114358143SRR13608004
658GAGTTACCAACCTTAACAGA-GGACCACAAAATCAGCAGGG113518227SRR21814508
658GAGTTACCAACCTTAACAGA-GGACCACAAAATCAGCAGGG114358143SRR13608004
659GATAATTGACTAAAAACATA-CAACGACATGATTGGTGTTT115493516SRR13608004
659GATAATTGACTAAAAACATA-CAACGACATGATTGGTGTTT43615684SRR21814497
660GATATGACTTGATGTCATGT-ACATGACATCAAGTCATATC28899SRR21814520
660GATATGACTTGATGTCATGT-ACATGACATCAAGTCATATC28903SRR21814520
661GATCGTGAGTGTAAGACCAG-CTGGTCTTACACTCACGATC116628756SRR21814513
661GATCGTGAGTGTAAGACCAG-CTGGTCTTACACTCACGATC116628765SRR21814513
662GATCTCTTATTTGAGAGAGT-GTGGAATTCGACCCTTAAGT117407923SRR21814491
662GATCTCTTATTTGAGAGAGT-GTGGAATTCGACCCTTAAGT511288941SRR21814491
663GATCTCTTATTTGAGAGAGT-TGTGGAATTCGACCCTTAAG117407923SRR21814496SRR21814499SRR21814504SRR21814514SRR21814516SRR21814518
663GATCTCTTATTTGAGAGAGT-TGTGGAATTCGACCCTTAAG511288941SRR21814496SRR21814499SRR21814504SRR21814514SRR21814516SRR21814518
664GATCTTAAAAGCATAAGTAG-TTGAGTATAACAACTTAAAC511733380SRR13608004
664GATCTTAAAAGCATAAGTAG-TTGAGTATAACAACTTAAAC511759103SRR13608004
665GATCTTATAAGCCTAAGTAG-ATATAAGAACTTAAACCGCA23622088SRR13608004
665GATCTTATAAGCCTAAGTAG-ATATAAGAACTTAAACCGCA43977497SRR21814486SRR21814490
666GATGAATTTGATAGGCTTTG-TGGAGAATCCACTCGACCAC113651859SRR13608004
666GATGAATTTGATAGGCTTTG-TGGAGAATCCACTCGACCAC24130715SRR21814492
667GATGGATTAGATTAGTGTAA-GAGTAGTGATTATGGTTCTT24780565SRR13608004
667GATGGATTAGATTAGTGTAA-GAGTAGTGATTATGGTTCTT314337795SRR13608004
668GATGGATTAGGAGTGTTTAT-AATTTGACTAATTATAAGAG114932061SRR13608004
668GATGGATTAGGAGTGTTTAT-AATTTGACTAATTATAAGAG114935230SRR13608004
669GATGGCAGTTTCTAGCGGTT-GTTTGGAGCCGTCAAGGTTG311330953SRR13608004
669GATGGCAGTTTCTAGCGGTT-GTTTGGAGCCGTCAAGGTTG42873063SRR13608004
670GATGGTCGTGAATACGAATC-GGATTCGTATTCACGACCAT55629142SRR13608004
670GATGGTCGTGAATACGAATC-GGATTCGTATTCACGACCAT55629147SRR13608004
671GATTAGGAGTGTTTAGACAA-GCACTTGACTAATTATAAGA44014884SRR21814489
671GATTAGGAGTGTTTAGACAA-GCACTTGACTAATTATAAGA44058952SRR21814489
672GATTAGTAAATATAATAGTT-CTTTAAATATTTATAAAAAA270733SRR21814495
672GATTAGTAAATATAATAGTT-CTTTAAATATTTATAAAAAA210465811SRR21814495
673GATTCCGGAAGCTAAAGTAG-ATAAGAACTAGAACCACAAC115114054SRR21814507
673GATTCCGGAAGCTAAAGTAG-ATAAGAACTAGAACCACAAC115138168SRR21814507
674GATTCTAGTTCTTATACTCA-CACTACTTTAGCTTTTGGGA42922611SRR21814505
674GATTCTAGTTCTTATACTCA-CACTACTTTAGCTTTTGGGA43041110SRR21814505
675GATTGCGGTTTAAGTTCTTA-ACTACTTAGGCGTTTAAGAT114484172SRR21814488SRR21814497
675GATTGCGGTTTAAGTTCTTA-ACTACTTAGGCGTTTAAGAT23624044SRR13608004
676GATTTATTTGTTAAAATGAC-TTGAATTGTAAATAAGTCCA118301101SRR21814503
676GATTTATTTGTTAAAATGAC-TTGAATTGTAAATAAGTCCA121616110SRR21814503
677GATTTGAAAGCATGTGTAGG-AATTAATGTTAAAGGGATTG114440891SRR13608004
677GATTTGAAAGCATGTGTAGG-AATTAATGTTAAAGGGATTG115191038SRR13608004
678GATTTTCCCGCCAAAAACGT-TTTTCCCGCCAAAAACGTAA125098611SRR21814501
678GATTTTCCCGCCAAAAACGT-TTTTCCCGCCAAAAACGTAA26715531SRR21814501
679GCAAAAAGAAGCTTGGTTAG-CCACACCATCAAAGCTTTGA115087686SRR13608004
679GCAAAAAGAAGCTTGGTTAG-CCACACCATCAAAGCTTTGA313592057SRR21814492
680GCAAAAATGTATATATAGAT-AAGATTTATTTCACAAAATG110161013SRR21814518
680GCAAAAATGTATATATAGAT-AAGATTTATTTCACAAAATG523050671SRR21814518
681GCAACCAGATCTTAAAAGCC-ATGGAGTATAAGAACTTAAA23606612SRR13608004
681GCAACCAGATCTTAAAAGCC-ATGGAGTATAAGAACTTAAA43977504SRR13608004
682GCAAGAAGAAGCTTGGTTAG-CTACACCATCAAAGCTTTGA114511131SRR13608004
682GCAAGAAGAAGCTTGGTTAG-CTACACCATCAAAGCTTTGA115311198SRR13608004
683GCAAGAAGAATATTGGTTAG-GCAAATATACTATGATACTT115093009SRR13608004
683GCAAGAAGAATATTGGTTAG-GCAAATATACTATGATACTT115167928SRR13608004
684GCAAGGATATCAAGGCTCTG-GGAGGAAGTGAGGACAAACA24208544SRR21814513
684GCAAGGATATCAAGGCTCTG-GGAGGAAGTGAGGACAAACA44277715SRR13608004
685GCAATCCAAAAGAATATTCA-TGAATATTCTTTTGGATTGC251198SRR13608004
685GCAATCCAAAAGAATATTCA-TGAATATTCTTTTGGATTGC251206SRR13608004
686GCAATGTTTTGAAACCCGAC-GGTCGGGCGTGAAAACACTG3188172SRR21814508
686GCAATGTTTTGAAACCCGAC-GGTCGGGCGTGAAAACACTG519818783SRR21814508
687GCACTTAAGGGTCGAATTCC-TTACTCCCTCAAATAAGAGA114208291SRR21814503
687GCACTTAAGGGTCGAATTCC-TTACTCCCTCAAATAAGAGA312745982SRR21814503
688GCAGCTCCAGGTTAGTTTTT-TAAAAACTAACCTGGAGCTG45771781SRR13608004
688GCAGCTCCAGGTTAGTTTTT-TAAAAACTAACCTGGAGCTG45771786SRR13608004
689GCAGTGTTTTCACGCCCGAC-GGTCGGTTTTAAAAACATTG124459732SRR21814505
689GCAGTGTTTTCACGCCCGAC-GGTCGGTTTTAAAAACATTG56106757SRR21814505
690GCAGTGTTTTCACGCCCGAC-GTCGGTTTTAAAAACATTGG124459732SRR21814492SRR21814493
690GCAGTGTTTTCACGCCCGAC-GTCGGTTTTAAAAACATTGG411475730SRR21814492SRR21814493
691GCATAGTGAGAAGAGTAAGT-ACTTACTCTTCTCACTATGC314193318SRR13608004
691GCATAGTGAGAAGAGTAAGT-ACTTACTCTTCTCACTATGC314193327SRR13608004
692GCATCAAAGCTCGTTAAGAC-GACCTTTGATGCATGAAAAA43054577SRR13608004
692GCATCAAAGCTCGTTAAGAC-GACCTTTGATGCATGAAAAA43054578SRR13608004
693GCATCAAAGCTCGTTAAGAC-GAGCTTTGATGCATGATAAA43054577SRR13608004
693GCATCAAAGCTCGTTAAGAC-GAGCTTTGATGCATGATAAA43054578SRR13608004
694GCATCAAAGCTCGTTAAGAC-GAGCTTTGATGCATGGAAAA43054577SRR13608004
694GCATCAAAGCTCGTTAAGAC-GAGCTTTGATGCATGGAAAA43054578SRR13608004
695GCATGTGCAAGTCCTTTTGT-GACAAAAGGACTTGCACATG313456013SRR13608004
695GCATGTGCAAGTCCTTTTGT-GACAAAAGGACTTGCACATG313456017SRR13608004
696GCATTGGATTGTGACACATT-CTCTAACTCTTGTAATTAGT114660727SRR21814512
696GCATTGGATTGTGACACATT-CTCTAACTCTTGTAATTAGT114941744SRR21814512
697GCCAAACAACTGGGTGGTCG-TATACTCGACTGCACAGTCT115493235SRR21814512SRR21814518
697GCCAAACAACTGGGTGGTCG-TATACTCGACTGCACAGTCT312983859SRR13608004
698GCCAAAGACTCATACAGACT-ACTGTTTCCTTGTTAGAAGA115083532SRR21814517
698GCCAAAGACTCATACAGACT-ACTGTTTCCTTGTTAGAAGA512026962SRR21814517
699GCCACGAATCTCTGGAATTA-TGCAACCAATACCTTGGTAC43096727SRR13608004
699GCCACGAATCTCTGGAATTA-TGCAACCAATACCTTGGTAC512530203SRR21814507
700GCCCTGAATGTTTTGTAGTT-AAACTGCAGCCATTCAAGGC23846123SRR13608004
700GCCCTGAATGTTTTGTAGTT-AAACTGCAGCCATTCAAGGC211729177SRR21814491
701GCCTAAATAGTGTTTCCTTG-AACAACTTAAACCGCAACCT23615116SRR21814510
701GCCTAAATAGTGTTTCCTTG-AACAACTTAAACCGCAACCT43969678SRR21814510
702GCCTAAGTAATGTTTCCTTG-ACTTAAACCACAACCTTATC43969678SRR21814507
702GCCTAAGTAATGTTTCCTTG-ACTTAAACCACAACCTTATC511916181SRR21814507
703GCCTCCGATAGAAACAACTT-CCAAGTTGTTTCTATCGGAG411049384SRR13608004
703GCCTCCGATAGAAACAACTT-CCAAGTTGTTTCTATCGGAG411049390SRR13608004
704GCCTCCGATAGAAACAACTT-TCCAAGTTGTTTCTATCGGA411049384SRR13608004
704GCCTCCGATAGAAACAACTT-TCCAAGTTGTTTCTATCGGA411049390SRR13608004
705GCCTTGAATGGCTGCAGTTT-AACTACAAAACATTCAGGGC23846119SRR13608004
705GCCTTGAATGGCTGCAGTTT-AACTACAAAACATTCAGGGC211729173SRR21814491
706GCCTTGAATGGCTGCAGTTT-ACTACAAAACATTCAGGGCC23846119SRR13608004
706GCCTTGAATGGCTGCAGTTT-ACTACAAAACATTCAGGGCC211729173SRR21814502SRR21814505SRR21814506
707GCGCGCGTGCGGGCAAAATT-TTTTTCTTTTTCTTATTCTT314194290SRR13608004
707GCGCGCGTGCGGGCAAAATT-TTTTTCTTTTTCTTATTCTT314194296SRR21814503
708GCGGTTTAAGTTGTTATACT-ACACTACTTAGGCTTTTAAG43977501SRR21814497
708GCGGTTTAAGTTGTTATACT-ACACTACTTAGGCTTTTAAG511683638SRR13608004
709GCGTTCATGGTGTAGCCAAA-AAACCTTCTTCTAGCTTCTC115082156SRR13608004
709GCGTTCATGGTGTAGCCAAA-AAACCTTCTTCTAGCTTCTC511728697SRR13608004
710GCTAAACAATCAAAGCTTTG-ACAAAGACTCATACGGAATT43966100SRR13608004
710GCTAAACAATCAAAGCTTTG-ACAAAGACTCATACGGAATT43968273SRR13608004
711GCTAAAGGATCTGGAAATTT-AAATTTCCAGATCCTTTAGC212658300SRR13608004
711GCTAAAGGATCTGGAAATTT-AAATTTCCAGATCCTTTAGC212658308SRR13608004
712GCTACACAATCAAAGCTTTG-AAAGCCAAAGACTCATACGT23719584SRR13608004
712GCTACACAATCAAAGCTTTG-AAAGCCAAAGACTCATACGT511972398SRR13608004
713GCTACACCATCAAAGCTTTG-CCAAAGACTCATACGGAGTT43042645SRR21814506SRR21814509
713GCTACACCATCAAAGCTTTG-CCAAAGACTCATACGGAGTT511963553SRR21814506SRR21814509
714GCTACACCATCAAAGCTTTG-GACAAAGACTCATACGAACT511757570SRR13608004
714GCTACACCATCAAAGCTTTG-GACAAAGACTCATACGAACT512062764SRR21814510
715GCTAGGTTATCTGTAGAATT-CATATGGTTTAGTAGATCGC116051133SRR21814488SRR21814505
715GCTAGGTTATCTGTAGAATT-CATATGGTTTAGTAGATCGC312323592SRR13608004
716GCTCGAAAACCTTCCAATCA-GACAGATCAGTAAGGATCCC114230680SRR13608004
716GCTCGAAAACCTTCCAATCA-GACAGATCAGTAAGGATCCC42833720SRR21814492
717GCTGAAAGGCCCCGATCCGG-TTGAGGATCGCGGGCGTTAC112714440SRR21814490
717GCTGAAAGGCCCCGATCCGG-TTGAGGATCGCGGGCGTTAC24264SRR21814490
718GCTGCTGCTGCTGCTGCTGC-CTGCTGCTGCTGCTGCTGCT216567614SRR21814490
718GCTGCTGCTGCTGCTGCTGC-CTGCTGCTGCTGCTGCTGCT217493102SRR21814490
718GCTGCTGCTGCTGCTGCTGC-CTGCTGCTGCTGCTGCTGCT218923773SRR21814490
718GCTGCTGCTGCTGCTGCTGC-CTGCTGCTGCTGCTGCTGCT320394678SRR21814490
718GCTGCTGCTGCTGCTGCTGC-CTGCTGCTGCTGCTGCTGCT526915851SRR21814490
719GCTTGACTGAGAATTGGAAG-CTTCCAATTCTCAGTCAAGC12975643SRR13608004
719GCTTGACTGAGAATTGGAAG-CTTCCAATTCTCAGTCAAGC12975652SRR13608004
720GCTTGGGGTTACACTCACGA-TCGTGAGTGTAACCCCAAGC314193541SRR13608004
720GCTTGGGGTTACACTCACGA-TCGTGAGTGTAACCCCAAGC314193548SRR13608004
721GCTTGGTTAGTGTTTTGGAG-AAGATTTGAGAAGCAAGAAG511824595SRR13608004
721GCTTGGTTAGTGTTTTGGAG-AAGATTTGAGAAGCAAGAAG512026308SRR13608004
722GCTTTGTATCTTCTAACAAG-CCAAAGTCCATATGAGTCTT43029799SRR13608004
722GCTTTGTATCTTCTAACAAG-CCAAAGTCCATATGAGTCTT511669070SRR13608004
723GCTTTGTATCTTCTAACAAG-CCAAAGTCCGTATGAGTGTT42967320SRR21814505
723GCTTTGTATCTTCTAACAAG-CCAAAGTCCGTATGAGTGTT43968471SRR13608004
724GCTTTGTTAGTGTTTCTATG-AAACATTGCTTAGAAGCAGT114660840SRR13608004
724GCTTTGTTAGTGTTTCTATG-AAACATTGCTTAGAAGCAGT44012585SRR21814512
725GGAAAAACGGTCATTTCATA-TATGAAATGACCGTTTTTCC312165774SRR21814491SRR21814514SRR21814517
725GGAAAAACGGTCATTTCATA-TATGAAATGACCGTTTTTCC312165783SRR21814491SRR21814514SRR21814517
725GGAAAAACGGTCATTTCATA-TATGAAATGACCGTTTTTCC314728242SRR21814511
725GGAAAAACGGTCATTTCATA-TATGAAATGACCGTTTTTCC314728251SRR21814511
726GGAAAAACGGTCTATTTCCC-GGGAAATAGACCGTTTTTCC17815898SRR21814520
726GGAAAAACGGTCTATTTCCC-GGGAAATAGACCGTTTTTCC17815906SRR21814520
726GGAAAAACGGTCTATTTCCC-GGGAAATAGACCGTTTTTCC515071302SRR21814520
726GGAAAAACGGTCTATTTCCC-GGGAAATAGACCGTTTTTCC515071310SRR21814520
727GGAAAATATGATTTTGCGGT-AATATGATTTTGCGATTTTG125723012SRR21814501
727GGAAAATATGATTTTGCGGT-AATATGATTTTGCGATTTTG47102264SRR21814501
728GGAAACACTACTTAGGCTTT-GAGTCTTTGTCTTTGTATCT43968668SRR21814505
728GGAAACACTACTTAGGCTTT-GAGTCTTTGTCTTTGTATCT512058459SRR13608004
729GGAAACACTACTTAGGCTTT-TTATCTTTGTATCTTCTAAC511963869SRR13608004
729GGAAACACTACTTAGGCTTT-TTATCTTTGTATCTTCTAAC512058459SRR13608004
730GGAACCAGCTACTAGATGGT-ACCATCTAGTAGCTGGTTCC314201060SRR13608004
730GGAACCAGCTACTAGATGGT-ACCATCTAGTAGCTGGTTCC314201066SRR13608004
731GGAACTTGGAAAAATCCTTG-ACCAAAATGAATATATTTTT23614020SRR21814503
731GGAACTTGGAAAAATCCTTG-ACCAAAATGAATATATTTTT23635257SRR21814503
732GGAACTTTTATCACTTATGC-GGCATAAGAGGTGAGCTCTC312150312SRR21814505SRR21814506
732GGAACTTTTATCACTTATGC-GGCATAAGAGGTGAGCTCTC411035851SRR21814505SRR21814506
733GGAAGAATTTCTATTCTGCC-GGCAGAATAGAACGTGGCTC249851SRR21814504
733GGAAGAATTTCTATTCTGCC-GGCAGAATAGAACGTGGCTC54796851SRR21814504
734GGAATTTGGCTAAACCATCA-AAACAAAGACAAAGACTCAT43971587SRR13608004
734GGAATTTGGCTAAACCATCA-AAACAAAGACAAAGACTCAT44003906SRR13608004
735GGACATCTCGGTATTTCGTG-CGCACGAAATACCGAGATGT22317SRR13608004
735GGACATCTCGGTATTTCGTG-CGCACGAAATACCGAGATGT22320SRR13608004
736GGAGAAACGGTCTATTTCCC-GGGAAATAGACCGTTTCTCC34775812SRR21814497SRR21814514
736GGAGAAACGGTCTATTTCCC-GGGAAATAGACCGTTTCTCC34775821SRR21814497SRR21814514
736GGAGAAACGGTCTATTTCCC-GGGAAATAGACCGTTTCTCC517077124SRR21814492SRR21814493SRR21814499SRR21814515
736GGAGAAACGGTCTATTTCCC-GGGAAATAGACCGTTTCTCC517077133SRR21814492SRR21814493SRR21814499SRR21814515
737GGAGCCACGTTCTATTCTGC-GGCAGAATAGAAATTCTTCC249844SRR21814504
737GGAGCCACGTTCTATTCTGC-GGCAGAATAGAAATTCTTCC54796858SRR21814504
738GGAGTGTTTAGACAACACTT-TCATAAGAGTTAGAGATGGA114804977SRR21814505
738GGAGTGTTTAGACAACACTT-TCATAAGAGTTAGAGATGGA44015038SRR21814505
739GGATATTTTTAAAAATGAAC-AATTTGGTCATTCTGTTCAA112337779SRR21814500
739GGATATTTTTAAAAATGAAC-AATTTGGTCATTCTGTTCAA25611031SRR21814500
740GGATTTATTTCACAAAATGG-ATTGTAAATAAGTCTCAACT118450354SRR21814493
740GGATTTATTTCACAAAATGG-ATTGTAAATAAGTCTCAACT47652606SRR21814493
741GGATTTTAAAAGGGTTTTAA-AAGGTTTTTAAAAGATTTAC118494018SRR21814496
741GGATTTTAAAAGGGTTTTAA-AAGGTTTTTAAAAGATTTAC26584222SRR21814496
742GGATTTTGATCTAGGTGATC-GATCACCTAGATCAAAATCC1197050SRR13608004
742GGATTTTGATCTAGGTGATC-GATCACCTAGATCAAAATCC1197058SRR13608004
743GGATTTTTAGTAATTAAACC-GTTTTATTACTAAAAACCCT129099460SRR21814490SRR21814500SRR21814501
743GGATTTTTAGTAATTAAACC-GTTTTATTACTAAAAACCCT29757879SRR21814515
743GGATTTTTAGTAATTAAACC-GTTTTATTACTAAAAACCCT213621895SRR21814487SRR21814490SRR21814515SRR21814517
743GGATTTTTAGTAATTAAACC-GTTTTATTACTAAAAACCCT35670961SRR21814496SRR21814499SRR21814500SRR21814501
743GGATTTTTAGTAATTAAACC-GTTTTATTACTAAAAACCCT36356211SRR21814487SRR21814490SRR21814517
743GGATTTTTAGTAATTAAACC-GTTTTATTACTAAAAACCCT411227991SRR21814490
743GGATTTTTAGTAATTAAACC-GTTTTATTACTAAAAACCCT54096948SRR21814499
743GGATTTTTAGTAATTAAACC-GTTTTATTACTAAAAACCCT521431831SRR21814496
744GGATTTTTAGTAATTAAACC-TTTTATTACTAAAAACCCTA213621895SRR21814514
744GGATTTTTAGTAATTAAACC-TTTTATTACTAAAAACCCTA411227991SRR21814514
745GGCAACATTTTACAACTCAG-CTGAGTTGTAAAATGTTGCC210592507SRR21814496
745GGCAACATTTTACAACTCAG-CTGAGTTGTAAAATGTTGCC210592515SRR21814496
746GGCCATGAATGTTTTGTTGA-AACCAGTACCATTCAAGGCC19732869SRR21814495
746GGCCATGAATGTTTTGTTGA-AACCAGTACCATTCAAGGCC316348097SRR21814495
747GGCCCTGAATGTTTTGTAGT-AAACTGCAGCCATTCAAGGC23846122SRR13608004
747GGCCCTGAATGTTTTGTAGT-AAACTGCAGCCATTCAAGGC211729176SRR21814506
748GGCCCTGTTCGTTTCCCTGT-ACAAGCAAACGAACAGGGCC210294037SRR21814509
748GGCCCTGTTCGTTTCCCTGT-ACAAGCAAACGAACAGGGCC210360556SRR21814494SRR21814509SRR21814516
748GGCCCTGTTCGTTTCCCTGT-ACAAGCAAACGAACAGGGCC31575987SRR21814494SRR21814506SRR21814516
748GGCCCTGTTCGTTTCCCTGT-ACAAGCAAACGAACAGGGCC36439018SRR21814494SRR21814506
749GGCCCTGTTCGTTTGCTTGT-ACAGGGAAACGAACAGGGCC210294035SRR21814509
749GGCCCTGTTCGTTTGCTTGT-ACAGGGAAACGAACAGGGCC210360554SRR21814494SRR21814509SRR21814516
749GGCCCTGTTCGTTTGCTTGT-ACAGGGAAACGAACAGGGCC31575989SRR21814494SRR21814516
749GGCCCTGTTCGTTTGCTTGT-ACAGGGAAACGAACAGGGCC36439020SRR21814494
750GGCCCTGTTCGTTTGCTTGT-GACAGGGAAACGAACAGGGC31575989SRR21814506
750GGCCCTGTTCGTTTGCTTGT-GACAGGGAAACGAACAGGGC36439020SRR21814506
751GGCCCTGTTTGTTTCATCAT-ATGGACAAACAAACAGGACC111958991SRR21814518
751GGCCCTGTTTGTTTCATCAT-ATGGACAAACAAACAGGACC121098502SRR21814518
752GGCCCTGTTTGTTTCATCAT-ATGGACAAACAAACAGGGCC121098502SRR21814508
752GGCCCTGTTTGTTTCATCAT-ATGGACAAACAAACAGGGCC414643620SRR21814508
752GGCCCTGTTTGTTTCATCAT-ATGGACAAACAAACAGGGCC58045613SRR21814508
753GGCCCTGTTTGTTTGATCAT-ATGGACAAACAAACAGGACC18279463SRR21814499
753GGCCCTGTTTGTTTGATCAT-ATGGACAAACAAACAGGACC318875400SRR21814499
754GGCCTTGAATGGTACTGGTT-TCAACAAAACATTCATGGCC19732867SRR21814495
754GGCCTTGAATGGTACTGGTT-TCAACAAAACATTCATGGCC316348095SRR21814495
755GGCTAAACAATCAAAGCTTT-TACAAAGACAAAGACTCATA511673315SRR13608004
755GGCTAAACAATCAAAGCTTT-TACAAAGACAAAGACTCATA511758102SRR13608004
755GGCTAAACAATCAAAGCTTT-TACAAAGACAAAGACTCATA511788386SRR13608004
756GGCTACACCATCAAAGCTTT-TACAAAGACAAAGACTCATA511756859SRR21814501
756GGCTACACCATCAAAGCTTT-TACAAAGACAAAGACTCATA511824560SRR13608004
757GGCTTAGGCTAAGAGACAAA-GGTTATGAACTCATTTGGTT113916875SRR13608004
757GGCTTAGGCTAAGAGACAAA-GGTTATGAACTCATTTGGTT314715982SRR21814511
758GGCTTTCCGAAAAGGTATCA-CTTGCTTCTTTCGTCGGAGG43054421SRR21814495
758GGCTTTCCGAAAAGGTATCA-CTTGCTTCTTTCGTCGGAGG512824130SRR21814495
759GGGAAAAAACCCGAAAAAAC-GTTTTTTCGGGTTTTTTCCC118895989SRR21814510SRR21814511SRR21814515
759GGGAAAAAACCCGAAAAAAC-GTTTTTTCGGGTTTTTTCCC118895998SRR21814510SRR21814511SRR21814515
760GGGAAAAAACCCGAAAAAAC-TTTTTTCGGGTTTTTTCCCG22358057SRR21814488
760GGGAAAAAACCCGAAAAAAC-TTTTTTCGGGTTTTTTCCCG22358066SRR21814488
761GGGAAAAAAGCCGAAAAAAC-GTTTTTTCGGCTTTTTTCCC523918572SRR21814515SRR21814517
761GGGAAAAAAGCCGAAAAAAC-GTTTTTTCGGCTTTTTTCCC523918581SRR21814515SRR21814517
762GGGAAAAATGTCAAAAAAAG-CTTTTTTTGACATTTTTCCC120449242SRR21814494SRR21814516
762GGGAAAAATGTCAAAAAAAG-CTTTTTTTGACATTTTTCCC120449251SRR21814494SRR21814516
763GGGAAAAATGTCATAAAAAT-ATTTTTATGACATTTTTCCCBRODYAGA1A DNA/MuDR212979052SRR21814500SRR21814501
763GGGAAAAATGTCATAAAAAT-ATTTTTATGACATTTTTCCCBRODYAGA1A DNA/MuDR212979061SRR21814500SRR21814501
764GGGAAAAATGTCATTTAATC-GATTAATTGACATTTTTCCCBOMZH1 DNA/MuDR122008360SRR21814502
764GGGAAAAATGTCATTTAATC-GATTAATTGACATTTTTCCCBOMZH1 DNA/MuDR47432226SRR21814502
765GGGAAAAATGTCGTTAAATC-GATTTAACGACATTTTTCCC113386818SRR21814516
765GGGAAAAATGTCGTTAAATC-GATTTAACGACATTTTTCCC113386827SRR21814516
765GGGAAAAATGTCGTTAAATC-GATTTAACGACATTTTTCCC320110791SRR21814490SRR21814497SRR21814500SRR21814501
765GGGAAAAATGTCGTTAAATC-GATTTAACGACATTTTTCCC320110800SRR21814490SRR21814497SRR21814500SRR21814501
765GGGAAAAATGTCGTTAAATC-GATTTAACGACATTTTTCCC59374320SRR21814487
765GGGAAAAATGTCGTTAAATC-GATTTAACGACATTTTTCCC59374329SRR21814487
765GGGAAAAATGTCGTTAAATC-GATTTAACGACATTTTTCCC517890009SRR21814487SRR21814498SRR21814505
765GGGAAAAATGTCGTTAAATC-GATTTAACGACATTTTTCCC517890018SRR21814487SRR21814498SRR21814505
766GGGAAAAATGTCGTTTTATA-TATAAAACGACATTTTTCCCATMU6N1 DNA/MuDR526071025SRR21814502
766GGGAAAAATGTCGTTTTATA-TATAAAACGACATTTTTCCCATMU6N1 DNA/MuDR526071034SRR21814502
767GGGAAAAATGTTATTTAATA-TATTAAATAACATTTTTCCCATMU3N1 DNA/MuDR17087883SRR21814504
767GGGAAAAATGTTATTTAATA-TATTAAATAACATTTTTCCCATMU3N1 DNA/MuDR119381514SRR21814501
767GGGAAAAATGTTATTTAATA-TATTAAATAACATTTTTCCCATMU3N1 DNA/MuDR119381523SRR21814501
767GGGAAAAATGTTATTTAATA-TATTAAATAACATTTTTCCCATMU3N1 DNA/MuDR125859830SRR21814517
767GGGAAAAATGTTATTTAATA-TATTAAATAACATTTTTCCCATMU3N1 DNA/MuDR125859839SRR21814517
767GGGAAAAATGTTATTTAATA-TATTAAATAACATTTTTCCCATMU3N1 DNA/MuDR126212102SRR21814496
767GGGAAAAATGTTATTTAATA-TATTAAATAACATTTTTCCCATMU3N1 DNA/MuDR126212111SRR21814496
767GGGAAAAATGTTATTTAATA-TATTAAATAACATTTTTCCCATMU3N1 DNA/MuDR317148317SRR21814504
767GGGAAAAATGTTATTTAATA-TATTAAATAACATTTTTCCCATMU3N1 DNA/MuDR317148326SRR21814504
767GGGAAAAATGTTATTTAATA-TATTAAATAACATTTTTCCCATMU3N1 DNA/MuDR414072586SRR21814487SRR21814494SRR21814496SRR21814498
767GGGAAAAATGTTATTTAATA-TATTAAATAACATTTTTCCCATMU3N1 DNA/MuDR414072595SRR21814487SRR21814494SRR21814496SRR21814498
768GGGAAAAATGTTGTTTTATA-TATAAAACAACATTTTTCCC12207376SRR21814489
768GGGAAAAATGTTGTTTTATA-TATAAAACAACATTTTTCCC12207385SRR21814489
768GGGAAAAATGTTGTTTTATA-TATAAAACAACATTTTTCCC18853957SRR21814488SRR21814496SRR21814520
768GGGAAAAATGTTGTTTTATA-TATAAAACAACATTTTTCCC18853966SRR21814488SRR21814496SRR21814520
768GGGAAAAATGTTGTTTTATA-TATAAAACAACATTTTTCCC521957656SRR21814488SRR21814496SRR21814497SRR21814507SRR21814508SRR21814512
768GGGAAAAATGTTGTTTTATA-TATAAAACAACATTTTTCCC521957665SRR21814488SRR21814496SRR21814497SRR21814507SRR21814508SRR21814512
769GGGAAATTGCAGTGTATAAC-TTACTTTTGCAATTCACCCT19896332SRR21814498SRR21814520
769GGGAAATTGCAGTGTATAAC-TTACTTTTGCAATTCACCCT123394967SRR21814498SRR21814520
769GGGAAATTGCAGTGTATAAC-TTACTTTTGCAATTCACCCT29562186SRR21814498
769GGGAAATTGCAGTGTATAAC-TTACTTTTGCAATTCACCCT218610690SRR21814520
769GGGAAATTGCAGTGTATAAC-TTACTTTTGCAATTCACCCT3907342SRR21814498
770GGGAAATTTACTAGAGTAAC-TCAATCTAAGCAAATCTTAC112478975SRR21814517
770GGGAAATTTACTAGAGTAAC-TCAATCTAAGCAAATCTTAC116308195SRR21814503
770GGGAAATTTACTAGAGTAAC-TCAATCTAAGCAAATCTTAC121779693SRR21814513
770GGGAAATTTACTAGAGTAAC-TCAATCTAAGCAAATCTTAC124295161SRR21814513
770GGGAAATTTACTAGAGTAAC-TCAATCTAAGCAAATCTTAC313983799SRR21814508
770GGGAAATTTACTAGAGTAAC-TCAATCTAAGCAAATCTTAC411047899SRR13608004
770GGGAAATTTACTAGAGTAAC-TCAATCTAAGCAAATCTTAC524328221SRR21814508SRR21814517
771GGGAAATTTGAAAAACTAAC-GTTATTCTTGCAATTCACCC316581667SRR21814502
771GGGAAATTTGAAAAACTAAC-GTTATTCTTGCAATTCACCC524514668SRR21814502
772GGGAAATTTGCAAATATAGC-TTATTGAGCTAATTCACCCT110696326SRR21814510
772GGGAAATTTGCAAATATAGC-TTATTGAGCTAATTCACCCT522012339SRR21814510
773GGGAAATTTGCATCTATAAC-GATATTCTTGCAATTGACCC119070332SRR21814499
773GGGAAATTTGCATCTATAAC-GATATTCTTGCAATTGACCC120479748SRR21814499SRR21814504
773GGGAAATTTGCATCTATAAC-GATATTCTTGCAATTGACCC57901936SRR21814504
774GGGAAATTTGGGTGTATAAC-GTTACTTTTGCAATTCACCC1325363SRR21814496SRR21814512
774GGGAAATTTGGGTGTATAAC-GTTACTTTTGCAATTCACCC22344412SRR21814512SRR21814516
774GGGAAATTTGGGTGTATAAC-GTTACTTTTGCAATTCACCC216558038SRR21814496
774GGGAAATTTGGGTGTATAAC-GTTACTTTTGCAATTCACCC36747327SRR21814512
774GGGAAATTTGGGTGTATAAC-GTTACTTTTGCAATTCACCC36802242SRR21814512
774GGGAAATTTGGGTGTATAAC-GTTACTTTTGCAATTCACCC58137604SRR21814516
775GGGAATGTGACACGTTTAGG-CCTCTACGTGTAATATTCTCVANDAL5A DNA/MuDR129999902SRR21814501
775GGGAATGTGACACGTTTAGG-CCTCTACGTGTAATATTCTCVANDAL5A DNA/MuDR213066459SRR13608004
775GGGAATGTGACACGTTTAGG-CCTCTACGTGTAATATTCTCVANDAL5A DNA/MuDR417352305SRR21814501SRR21814515
776GGGAATGTGACACGTTTAGG-TCTTAGAGTGTAATATTCTC118768739SRR21814490
776GGGAATGTGACACGTTTAGG-TCTTAGAGTGTAATATTCTC25057821SRR21814513
776GGGAATGTGACACGTTTAGG-TCTTAGAGTGTAATATTCTC35710839SRR21814490SRR21814495SRR21814507SRR21814511SRR21814513SRR21814514SRR21814516SRR21814518
776GGGAATGTGACACGTTTAGG-TCTTAGAGTGTAATATTCTC35710865SRR21814495
776GGGAATGTGACACGTTTAGG-TCTTAGAGTGTAATATTCTC411839690SRR21814511
776GGGAATGTGACACGTTTAGG-TCTTAGAGTGTAATATTCTC511018960SRR21814495SRR21814507SRR21814513SRR21814514SRR21814516SRR21814518
777GGGAATTTAATGAAAAAAAA-TTTTTTTCATTAAATTCCCT112255991SRR21814492
777GGGAATTTAATGAAAAAAAA-TTTTTTTCATTAAATTCCCT123802715SRR21814492
778GGGAATTTAATGAAAAAAAC-GTTTTTTTCATTAAATTCCCAT9NMU1 DNA/MuDR112255991SRR21814493
778GGGAATTTAATGAAAAAAAC-GTTTTTTTCATTAAATTCCCAT9NMU1 DNA/MuDR123802707SRR21814493
778GGGAATTTAATGAAAAAAAC-GTTTTTTTCATTAAATTCCCAT9NMU1 DNA/MuDR123802715SRR21814493
778GGGAATTTAATGAAAAAAAC-GTTTTTTTCATTAAATTCCCAT9NMU1 DNA/MuDR2923691SRR21814501
778GGGAATTTAATGAAAAAAAC-GTTTTTTTCATTAAATTCCCAT9NMU1 DNA/MuDR2923699SRR21814501
778GGGAATTTAATGAAAAAAAC-GTTTTTTTCATTAAATTCCCAT9NMU1 DNA/MuDR210580835SRR21814514
778GGGAATTTAATGAAAAAAAC-GTTTTTTTCATTAAATTCCCAT9NMU1 DNA/MuDR210580843SRR21814514
778GGGAATTTAATGAAAAAAAC-GTTTTTTTCATTAAATTCCCAT9NMU1 DNA/MuDR310854728SRR21814501SRR21814514SRR21814515
778GGGAATTTAATGAAAAAAAC-GTTTTTTTCATTAAATTCCCAT9NMU1 DNA/MuDR310854736SRR21814501SRR21814514SRR21814515
779GGGAATTTAATGAAAAAAAC-TTTTTTCATTAAATTCCCTA124289452SRR21814491
779GGGAATTTAATGAAAAAAAC-TTTTTTCATTAAATTCCCTA526746313SRR21814491
780GGGAATTTAATGAAAAAAAC-TTTTTTTCATTAAATTCCCA48959152SRR21814486
780GGGAATTTAATGAAAAAAAC-TTTTTTTCATTAAATTCCCA515941140SRR21814486
781GGGAATTTAATGAAAAAAAC-TTTTTTTCATTAAATTCCCT124289444SRR21814495
781GGGAATTTAATGAAAAAAAC-TTTTTTTCATTAAATTCCCT124289452SRR21814495
781GGGAATTTAATGAAAAAAAC-TTTTTTTCATTAAATTCCCT2679885SRR21814512
781GGGAATTTAATGAAAAAAAC-TTTTTTTCATTAAATTCCCT2679893SRR21814512
781GGGAATTTAATGAAAAAAAC-TTTTTTTCATTAAATTCCCT210580835SRR21814516
781GGGAATTTAATGAAAAAAAC-TTTTTTTCATTAAATTCCCT310854736SRR21814495
781GGGAATTTAATGAAAAAAAC-TTTTTTTCATTAAATTCCCT41533309SRR21814497SRR21814516
781GGGAATTTAATGAAAAAAAC-TTTTTTTCATTAAATTCCCT41533317SRR21814497SRR21814516
781GGGAATTTAATGAAAAAAAC-TTTTTTTCATTAAATTCCCT48959144SRR21814496
781GGGAATTTAATGAAAAAAAC-TTTTTTTCATTAAATTCCCT514045102SRR21814496
781GGGAATTTAATGAAAAAAAC-TTTTTTTCATTAAATTCCCT526746313SRR21814495SRR21814516
782GGGATCCTTACTGATCTGTC-ATTGGAAGGTTTTCGAGCAA114230672SRR13608004
782GGGATCCTTACTGATCTGTC-ATTGGAAGGTTTTCGAGCAA42833712SRR21814492
783GGGCTGACATGGATTCTCCT-AGGAGAATCCATGTCAGCCC53253200SRR13608004
783GGGCTGACATGGATTCTCCT-AGGAGAATCCATGTCAGCCC53253208SRR13608004
784GGGCTGCCTATAGGAGGCCC-GGGCCTCCTATAGGCAGCCC129630582SRR21814498SRR21814502SRR21814505SRR21814506
784GGGCTGCCTATAGGAGGCCC-GGGCCTCCTATAGGCAGCCC129630590SRR21814498SRR21814502SRR21814505SRR21814506
785GGGCTTATTGGCAAAATAGA-TCTACTTTCCAACTTATCTC214451176SRR21814510
785GGGCTTATTGGCAAAATAGA-TCTACTTTCCAACTTATCTC524323262SRR21814510
786GGGGAATTGGCAAAACTAAC-TATATCTGCAAATCACCCTA112938763SRR21814501SRR21814515
786GGGGAATTGGCAAAACTAAC-TATATCTGCAAATCACCCTA22175146SRR21814501SRR21814515
787GGGTAAATTGCAGGCCACAC-CACTTTTGTGAAAATTTCTTVANDAL2 DNA/MuDR113824178SRR21814508
787GGGTAAATTGCAGGCCACAC-CACTTTTGTGAAAATTTCTTVANDAL2 DNA/MuDR118222061SRR21814496
787GGGTAAATTGCAGGCCACAC-CACTTTTGTGAAAATTTCTTVANDAL2 DNA/MuDR121177621SRR21814494SRR21814501
787GGGTAAATTGCAGGCCACAC-CACTTTTGTGAAAATTTCTTVANDAL2 DNA/MuDR122116998SRR21814494SRR21814496SRR21814517
787GGGTAAATTGCAGGCCACAC-CACTTTTGTGAAAATTTCTTVANDAL2 DNA/MuDR21400077SRR21814501SRR21814517
787GGGTAAATTGCAGGCCACAC-CACTTTTGTGAAAATTTCTTVANDAL2 DNA/MuDR35621228SRR21814508SRR21814517
787GGGTAAATTGCAGGCCACAC-CACTTTTGTGAAAATTTCTTVANDAL2 DNA/MuDR318226443SRR21814517
787GGGTAAATTGCAGGCCACAC-CACTTTTGTGAAAATTTCTTVANDAL2 DNA/MuDR322230587SRR21814494SRR21814501
788GGGTAATATTAGAAACTAAC-TCATCTAGTGCATATTCTCT210729870SRR21814519
788GGGTAATATTAGAAACTAAC-TCATCTAGTGCATATTCTCT47926601SRR21814519
789GGGTATATGCACTAGATGAC-TCATTCAGTAAATTAACCCT122305255SRR21814501SRR21814505SRR21814510SRR21814511
789GGGTATATGCACTAGATGAC-TCATTCAGTAAATTAACCCT129268246SRR21814501
789GGGTATATGCACTAGATGAC-TCATTCAGTAAATTAACCCT33120911SRR13608004
790GGGTATATGCACTAGATGAC-TTCAGTAAATTAACCCTTTA33120911SRR13608004
790GGGTATATGCACTAGATGAC-TTCAGTAAATTAACCCTTTA311135229SRR21814498
791GGGTCAATTGCAAGAATATC-GTTATAGATGCAAATTTCCC119070324SRR21814499
791GGGTCAATTGCAAGAATATC-GTTATAGATGCAAATTTCCC120479740SRR21814499SRR21814504
791GGGTCAATTGCAAGAATATC-GTTATAGATGCAAATTTCCC57901944SRR21814504
792GGGTCATAGGAAACATTCCT-ATTGATCGTTCCAAATAATG114212021SRR21814489
792GGGTCATAGGAAACATTCCT-ATTGATCGTTCCAAATAATG44140428SRR21814489
793GGGTGAATTAGCTCAATAAC-GCTATATTTGCAAATTTCCCVANDAL16 DNA/MuDR110696334SRR21814510
793GGGTGAATTAGCTCAATAAC-GCTATATTTGCAAATTTCCCVANDAL16 DNA/MuDR522012331SRR21814510
794GGGTGAATTGCAAAAGTAAC-GTTATACACCCAAATTTCCC1325355SRR21814496SRR21814512
794GGGTGAATTGCAAAAGTAAC-GTTATACACCCAAATTTCCC22344420SRR21814512SRR21814516
794GGGTGAATTGCAAAAGTAAC-GTTATACACCCAAATTTCCC216558030SRR21814496
794GGGTGAATTGCAAAAGTAAC-GTTATACACCCAAATTTCCC36747335SRR21814512
794GGGTGAATTGCAAAAGTAAC-GTTATACACCCAAATTTCCC36802250SRR21814512
794GGGTGAATTGCAAAAGTAAC-GTTATACACCCAAATTTCCC58137612SRR21814516
795GGGTGAATTGCAAAAGTAAC-GTTATACACTGCAATTTCCC19896340SRR21814520
795GGGTGAATTGCAAAAGTAAC-GTTATACACTGCAATTTCCC123394959SRR21814520
795GGGTGAATTGCAAAAGTAAC-GTTATACACTGCAATTTCCC218610682SRR21814520
796GGGTGAATTGCAAGAATAAC-GTTAGTTTTTCAAATTTCCC316581675SRR21814502
796GGGTGAATTGCAAGAATAAC-GTTAGTTTTTCAAATTTCCC524514676SRR21814502
797GGGTGGTTCGCCGCCCGCGA-GAAGTGTTCGGATCGCGGCC25403SRR13608004
797GGGTGGTTCGCCGCCCGCGA-GAAGTGTTCGGATCGCGGCC25405SRR21814490
798GGGTGTATTGGCAAAATAGT-AGTAATTTGCAACTTAACCC213517439SRR21814518
798GGGTGTATTGGCAAAATAGT-AGTAATTTGCAACTTAACCC58765215SRR21814518
799GGGTTAAGTTGCAAATTACT-ACTATTTTGCCAATACACCC213517431SRR21814518
799GGGTTAAGTTGCAAATTACT-ACTATTTTGCCAATACACCC58765207SRR21814518
800GGGTTAATTTACTGAATGAC-GTCATCTAGTGCATATACCCVANDAL14 DNA/MuDR122305263SRR21814501
800GGGTTAATTTACTGAATGAC-GTCATCTAGTGCATATACCCVANDAL14 DNA/MuDR129268238SRR21814501
801GGGTTAATTTGCAAACTAGT-ACTATTTTGCCAACACACCC16657016SRR21814504
801GGGTTAATTTGCAAACTAGT-ACTATTTTGCCAACACACCC215348087SRR21814504
802GGGTTGGCTGATTTTATACC-GGTATAAAATCAGCCAACCC25417285SRR21814486SRR21814491SRR21814501SRR21814513SRR21814515
802GGGTTGGCTGATTTTATACC-GGTATAAAATCAGCCAACCC25417293SRR21814486SRR21814491SRR21814501SRR21814513SRR21814515
803GGGTTGGCTGATTTTATAGC-GCTATAAAATCAGCCAACCC42029642SRR21814512SRR21814516
803GGGTTGGCTGATTTTATAGC-GCTATAAAATCAGCCAACCC42029650SRR21814512SRR21814516
804GGGTTGGCTGATTTTCGAGC-GCTCGAAAATCAGCCAACCC315505054SRR21814501SRR21814505SRR21814506
804GGGTTGGCTGATTTTCGAGC-GCTCGAAAATCAGCCAACCC315505062SRR21814501SRR21814505SRR21814506
805GGGTTTACGTTTTTGGCGGG-ACGGATTTACGTTTTTGGCG26715532SRR21814505SRR21814518
805GGGTTTACGTTTTTGGCGGG-ACGGATTTACGTTTTTGGCG43133471SRR21814505SRR21814518
806GGGTTTATTGTAAAAGTAGG-CCTAGTTCTCAACTTATCTC316706243SRR21814496
806GGGTTTATTGTAAAAGTAGG-CCTAGTTCTCAACTTATCTC47146590SRR21814496
807GGGTTTTCTGCAAAATAACC-GGTTATTTTGCAGAAAACCCATMUNX1 DNA/MuDR310553007SRR21814486SRR21814487SRR21814491SRR21814492SRR21814493SRR21814508SRR21814511
807GGGTTTTCTGCAAAATAACC-GGTTATTTTGCAGAAAACCCATMUNX1 DNA/MuDR310553015SRR21814486SRR21814487SRR21814491SRR21814492SRR21814493SRR21814508SRR21814511
808GGGTTTTTAGTAATAAAACC-GGTTTAATTACTAAAAATCC129099468SRR21814490
808GGGTTTTTAGTAATAAAACC-GGTTTAATTACTAAAAATCC213621903SRR21814487SRR21814490
808GGGTTTTTAGTAATAAAACC-GGTTTAATTACTAAAAATCC36356219SRR21814487SRR21814490
809GGGTTTTTAGTAATAAAACC-GTTTAATTACTAAAAATCCT129099468SRR21814500SRR21814501
809GGGTTTTTAGTAATAAAACC-GTTTAATTACTAAAAATCCT22139711SRR21814504SRR21814513
809GGGTTTTTAGTAATAAAACC-GTTTAATTACTAAAAATCCT29757871SRR21814515
809GGGTTTTTAGTAATAAAACC-GTTTAATTACTAAAAATCCT213621903SRR21814504SRR21814513SRR21814515
809GGGTTTTTAGTAATAAAACC-GTTTAATTACTAAAAATCCT35670953SRR21814496SRR21814500SRR21814501
809GGGTTTTTAGTAATAAAACC-GTTTAATTACTAAAAATCCT521431839SRR21814496
810GGTAAATTGCACACAGTAGC-TTATAACGTGAAATTTTCTTVANDAL1 DNA/MuDR117528699SRR21814515
810GGTAAATTGCACACAGTAGC-TTATAACGTGAAATTTTCTTVANDAL1 DNA/MuDR27024582SRR21814515
811GGTATACCGCAGGTTAAAAT-AACTTTAAAAAATAAATTGT219623621SRR13608004
811GGTATACCGCAGGTTAAAAT-AACTTTAAAAAATAAATTGT316234685SRR13608004
812GGTCCTGTTTGTTTGTCCAT-ATGATGAAACAAACAGGGCC111958993SRR21814518
812GGTCCTGTTTGTTTGTCCAT-ATGATGAAACAAACAGGGCC121098500SRR21814518
813GGTCCTGTTTGTTTGTCCAT-TGATCAAACAAACAGGGCCT18279465SRR21814499
813GGTCCTGTTTGTTTGTCCAT-TGATCAAACAAACAGGGCCT318875398SRR21814499
814GGTCGAGTAGAAGACATCAC-GTGATGTCTTCTACTCGACC114315387SRR13608004
814GGTCGAGTAGAAGACATCAC-GTGATGTCTTCTACTCGACC114315390SRR13608004
815GGTCGAGTATGGTGCTGGAT-GGCTCCAAAGTCACTCGACC113940906SRR13608004
815GGTCGAGTATGGTGCTGGAT-GGCTCCAAAGTCACTCGACC113947010SRR21814505
815GGTCGAGTATGGTGCTGGAT-GGCTCCAAAGTCACTCGACC511926576SRR13608004
816GGTCGAGTGATGTGATAGAG-CGATCACATCACTCGACCTC115617633SRR13608004
816GGTCGAGTGATGTGATAGAG-CGATCACATCACTCGACCTC315152638SRR13608004
817GGTTAAAATTCCGGAACCGG-AAGCGCGAACTTCGAAAGGG27982SRR13608004
817GGTTAAAATTCCGGAACCGG-AAGCGCGAACTTCGAAAGGG314201703SRR21814508
818GGTTAAAATTCCGGAACCGG-AGCGCGAACTTCGAAAGGGG27982SRR13608004
818GGTTAAAATTCCGGAACCGG-AGCGCGAACTTCGAAAGGGG314201703SRR21814493
819GGTTAAGTTCTTATACTCAA-TACGCCTTTAAGATCCGGTT313587162SRR13608004
819GGTTAAGTTCTTATACTCAA-TACGCCTTTAAGATCCGGTT43965998SRR13608004
820GGTTAAGTTCTTATACTCAA-TAGGCTCTTAAGATCGGGTT313587162SRR13608004
820GGTTAAGTTCTTATACTCAA-TAGGCTCTTAAGATCGGGTT43965998SRR13608004
821GGTTAAGTTCTTATACTCAA-TAGGCTTACAAGATCGGGTT23617580SRR13608004
821GGTTAAGTTCTTATACTCAA-TAGGCTTACAAGATCGGGTT313587162SRR13608004
822GGTTCAACTGGAATGTTACT-TAGTAACATTCCAGTTGAAC26079410SRR13608004
822GGTTCAACTGGAATGTTACT-TAGTAACATTCCAGTTGAAC26079418SRR13608004
823GGTTGCGGTTTAAGTTCTCA-AGAAAACACTACTTAGGCTT43969688SRR21814519
823GGTTGCGGTTTAAGTTCTCA-AGAAAACACTACTTAGGCTT511703383SRR13608004
824GGTTGGTTAGTGTTTTGGAG-CCATCAAAGCTTTGAGAAGC115437520SRR21814510
824GGTTGGTTAGTGTTTTGGAG-CCATCAAAGCTTTGAGAAGC511683351SRR13608004
825GGTTTAAGTTCTTATACTCA-ATTCTTACGCCTTTAAGATC23624393SRR21814511
825GGTTTAAGTTCTTATACTCA-ATTCTTACGCCTTTAAGATC511671071SRR21814511
826GGTTTGATGTCTCTCCTTCT-GAAGGAGAGACATCAAACCC21810873SRR13608004
826GGTTTGATGTCTCTCCTTCT-GAAGGAGAGACATCAAACCC21810881SRR13608004
827GTAAACTTTTCTCGACGATT-GTCCTGGTCGACGATTCCTC112379268SRR21814518
827GTAAACTTTTCTCGACGATT-GTCCTGGTCGACGATTCCTC210198SRR21814518
828GTAAGATTTGCTTAGATTGA-GTTACTCTAGTAAATTTCCC111887997SRR21814492
828GTAAGATTTGCTTAGATTGA-GTTACTCTAGTAAATTTCCC112478967SRR21814517
828GTAAGATTTGCTTAGATTGA-GTTACTCTAGTAAATTTCCC112825799SRR13608004
828GTAAGATTTGCTTAGATTGA-GTTACTCTAGTAAATTTCCC116308187SRR21814503
828GTAAGATTTGCTTAGATTGA-GTTACTCTAGTAAATTTCCC121779701SRR21814513
828GTAAGATTTGCTTAGATTGA-GTTACTCTAGTAAATTTCCC124295169SRR21814501SRR21814513
828GTAAGATTTGCTTAGATTGA-GTTACTCTAGTAAATTTCCC313983807SRR21814487SRR21814508
828GTAAGATTTGCTTAGATTGA-GTTACTCTAGTAAATTTCCC411047891SRR13608004
828GTAAGATTTGCTTAGATTGA-GTTACTCTAGTAAATTTCCC514676835SRR21814491
828GTAAGATTTGCTTAGATTGA-GTTACTCTAGTAAATTTCCC524328213SRR21814500SRR21814501SRR21814506SRR21814508SRR21814517
829GTAAGATTTGCTTAGATTGA-TACTCTAGTAAATTTCCCAA112825799SRR13608004
829GTAAGATTTGCTTAGATTGA-TACTCTAGTAAATTTCCCAA411047891SRR13608004
830GTAAGATTTGCTTAGATTGA-TTACTCTAGTAAATTTCCCT116791038SRR21814498
830GTAAGATTTGCTTAGATTGA-TTACTCTAGTAAATTTCCCT520175022SRR21814498
831GTAATATTTGACTCCAAAAC-TTATACTCAATCATACACAT43202921SRR13608004
831GTAATATTTGACTCCAAAAC-TTATACTCAATCATACACAT512026162SRR13608004
832GTAGCCGAAGTCCGTATGAA-TTGCTTCTCAAAGCTTTGAT114484277SRR21814510
832GTAGCCGAAGTCCGTATGAA-TTGCTTCTCAAAGCTTTGAT511956780SRR13608004
833GTAGTATGAAGTGCTACTCG-AGGGGAAGGTTTAAAAAACC22932SRR21814488
833GTAGTATGAAGTGCTACTCG-AGGGGAAGGTTTAAAAAACC22935SRR13608004
834GTATAAAAACTTAAACCGCA-TTGATGTCATGTGTATGATT43966015SRR13608004
834GTATAAAAACTTAAACCGCA-TTGATGTCATGTGTATGATT43972382SRR13608004
835GTATAAGAACTTAAACCGCA-AATATGACTTGATGTCATGT23602544SRR13608004
835GTATAAGAACTTAAACCGCA-AATATGACTTGATGTCATGT43041430SRR13608004
835GTATAAGAACTTAAACCGCA-AATATGACTTGATGTCATGT511737626SRR13608004
835GTATAAGAACTTAAACCGCA-AATATGACTTGATGTCATGT512028661SRR13608004
836GTATATTACGATTGTACAAT-ATTGTACAATCGTAATATAC116988723SRR13608004
836GTATATTACGATTGTACAAT-ATTGTACAATCGTAATATAC116988730SRR13608004
837GTATGAGTCTTTGGCTTTGT-CTCAAAGCTTTCATGGTGTA42919291SRR21814492
837GTATGAGTCTTTGGCTTTGT-CTCAAAGCTTTCATGGTGTA511705438SRR21814492
838GTATGATTGAGTATAACAAC-CAAATATGACTAGATGTCAT115084870SRR21814492
838GTATGATTGAGTATAACAAC-CAAATATGACTAGATGTCAT42966349SRR13608004
838GTATGATTGAGTATAACAAC-CAAATATGACTAGATGTCAT511736904SRR13608004
839GTATTGGGGATATATGTTAT-GTTCAATACCTTATTCTACAATCOPIA13 LTR/Copia2337182SRR21814497
839GTATTGGGGATATATGTTAT-GTTCAATACCTTATTCTACAATCOPIA13 LTR/Copia210158159SRR21814497
840GTATTTAGACAACACTTATA-TAATAAGAGTTAGAGATGGA114609631SRR21814486
840GTATTTAGACAACACTTATA-TAATAAGAGTTAGAGATGGA115013025SRR21814486
841GTCACAATCTAATGCATTTG-CTGTGTTTCTATGGTCAAAA114690650SRR21814495
841GTCACAATCTAATGCATTTG-CTGTGTTTCTATGGTCAAAA44012078SRR21814495
841GTCACAATCTAATGCATTTG-CTGTGTTTCTATGGTCAAAA44057325SRR21814495
842GTCATATTCGACTCCAAAAC-CTCACTAATACACATGACAT114510063SRR13608004
842GTCATATTCGACTCCAAAAC-CTCACTAATACACATGACAT511964330SRR13608004
843GTCGAGTATGGTGCTGGATG-GGCTCCAAAGTCACTCGACC113947011SRR21814500
843GTCGAGTATGGTGCTGGATG-GGCTCCAAAGTCACTCGACC511926577SRR13608004
844GTCGAGTATGGTGCTGGATG-TGGCTCCAAAGTCACTCGAC113947011SRR21814518
844GTCGAGTATGGTGCTGGATG-TGGCTCCAAAGTCACTCGAC311900348SRR21814488SRR21814496SRR21814497SRR21814504SRR21814518
844GTCGAGTATGGTGCTGGATG-TGGCTCCAAAGTCACTCGAC511926577SRR13608004
845GTCGAGTGACTTTGGAGCCA-ATCCAGCACCATACTCGACC311900353SRR21814504
845GTCGAGTGACTTTGGAGCCA-ATCCAGCACCATACTCGACC511926572SRR13608004
846GTCGAGTGACTTTGGAGCCA-CATCCAGCACCATACTCGAC311900353SRR21814496SRR21814518
846GTCGAGTGACTTTGGAGCCA-CATCCAGCACCATACTCGAC511926572SRR13608004
847GTCGAGTGTCTTCAGCTCCA-TGGAGCTGAAGACACTCGAC22488135SRR13608004
847GTCGAGTGTCTTCAGCTCCA-TGGAGCTGAAGACACTCGAC22488140SRR13608004
848GTCGCCGGAAAAGTTTTCCG-AGGCAACAAAACCGATCGCC22001SRR13608004
848GTCGCCGGAAAAGTTTTCCG-AGGCAACAAAACCGATCGCC22013SRR13608004
849GTCTTCCTCTAGCAAAATTT-GAAATTTTGCTAGAGGAAGA118006182SRR13608004
849GTCTTCCTCTAGCAAAATTT-GAAATTTTGCTAGAGGAAGA118006187SRR13608004
850GTGAAAGGCCCCGATCCGGA-TGAGGATCGCGGGCGTTACA22735SRR21814504
850GTGAAAGGCCCCGATCCGGA-TGAGGATCGCGGGCGTTACA24111SRR21814504
850GTGAAAGGCCCCGATCCGGA-TGAGGATCGCGGGCGTTACA24137SRR21814504
850GTGAAAGGCCCCGATCCGGA-TGAGGATCGCGGGCGTTACA24488SRR21814504
850GTGAAAGGCCCCGATCCGGA-TGAGGATCGCGGGCGTTACA25103SRR21814504
850GTGAAAGGCCCCGATCCGGA-TGAGGATCGCGGGCGTTACA27183SRR21814504
850GTGAAAGGCCCCGATCCGGA-TGAGGATCGCGGGCGTTACA27262SRR21814504
850GTGAAAGGCCCCGATCCGGA-TGAGGATCGCGGGCGTTACA28264SRR21814504
850GTGAAAGGCCCCGATCCGGA-TGAGGATCGCGGGCGTTACA314193299SRR21814504
851GTGATGACTATCCTTGCGGT-CACCGCAAGGATAGTCATCA318792736SRR13608004
851GTGATGACTATCCTTGCGGT-CACCGCAAGGATAGTCATCA318792743SRR13608004
852GTGGTCACTTCTTGGAAGGT-TACCTTCCAAGAAGTGACCA46500025SRR13608004
852GTGGTCACTTCTTGGAAGGT-TACCTTCCAAGAAGTGACCA46500031SRR13608004
853GTGGTTTGGAGTCGAATATG-AGAAGCAAGAAGAAGGTTGG43967162SRR13608004
853GTGGTTTGGAGTCGAATATG-AGAAGCAAGAAGAAGGTTGG511726055SRR13608004
854GTGTAATGCTAACAATCAAG-ATTTTAGGTATCAATCCAAA113712423SRR21814499
854GTGTAATGCTAACAATCAAG-ATTTTAGGTATCAATCCAAA511079915SRR13608004
855GTGTATGATTGAGTATAAAA-AGTCGAATATGACTTGATCT312672033SRR21814497
855GTGTATGATTGAGTATAAAA-AGTCGAATATGACTTGATCT511790060SRR21814497
856GTGTCGATCGACACCATCGG-AGATGGTGTCGATCGACACC113299917SRR13608004
856GTGTCGATCGACACCATCGG-AGATGGTGTCGATCGACACC113594706SRR13608004
857GTGTCGATCGACACCATCGG-CAGATGGTGTCGATCGACAC113299917SRR13608004
857GTGTCGATCGACACCATCGG-CAGATGGTGTCGATCGACAC113594706SRR13608004
858GTGTGTGTGTGTGTGTGTGT-GTGCATGTGTGTGTGTGTGT34638054SRR21814486
858GTGTGTGTGTGTGTGTGTGT-GTGCATGTGTGTGTGTGTGT413940748SRR21814486
859GTGTTAGAGTAAAATTCTTT-ATCAAGTTTAACTTTCAACA210658070SRR13608004
859GTGTTAGAGTAAAATTCTTT-ATCAAGTTTAACTTTCAACA56916798SRR21814512
860GTGTTTAGACAACATTTATA-CATAAGAGTTAGAGATGGAG114669707SRR21814492
860GTGTTTAGACAACATTTATA-CATAAGAGTTAGAGATGGAG114890022SRR21814492
860GTGTTTAGACAACATTTATA-CATAAGAGTTAGAGATGGAG114944437SRR21814492
861GTGTTTTGGAGTCGAATATG-CTTTGAGAAGCTAGAAGAAG42967561SRR21814491
861GTGTTTTGGAGTCGAATATG-CTTTGAGAAGCTAGAAGAAG511705031SRR13608004
862GTTAAGTTCTTATACTCAAT-ACGCCTTTAAGATCCGGTTG23606613SRR13608004
862GTTAAGTTCTTATACTCAAT-ACGCCTTTAAGATCCGGTTG43965999SRR13608004
862GTTAAGTTCTTATACTCAAT-ACGCCTTTAAGATCCGGTTG511660536SRR13608004
862GTTAAGTTCTTATACTCAAT-ACGCCTTTAAGATCCGGTTG511732519SRR13608004
863GTTACGGTTTAAGTTGTTAT-AATTCTTACGCCTTTAAGAT23624043SRR21814504
863GTTACGGTTTAAGTTGTTAT-AATTCTTACGCCTTTAAGAT511734089SRR13608004
864GTTATTTTGGAAAGAAGACG-TTCGTCTTCTTTCCAAAATA112951127SRR13608004
864GTTATTTTGGAAAGAAGACG-TTCGTCTTCTTTCCAAAATA112951134SRR13608004
865GTTCAACTGGAATGTTACTA-AGTAACATTCCAGTTGAACC26079409SRR13608004
865GTTCAACTGGAATGTTACTA-AGTAACATTCCAGTTGAACC26079419SRR13608004
866GTTCTAACAGAATAGATAAA-TTTATCTATTCTGTTAGAAC119268580SRR21814510
866GTTCTAACAGAATAGATAAA-TTTATCTATTCTGTTAGAAC119268589SRR21814510
867GTTCTTATACTCAATCATAC-ACAAGATCGGGTTGCGGTTT42921356SRR13608004
867GTTCTTATACTCAATCATAC-ACAAGATCGGGTTGCGGTTT512064701SRR13608004
868GTTGCGGTTATAGTTCTTAT-ACAACTTTAGCTTTTGGGAA115098231SRR13608004
868GTTGCGGTTATAGTTCTTAT-ACAACTTTAGCTTTTGGGAA42925818SRR13608004
869GTTGCGGTTTAAGTTCTTAT-AATTCTTACGCCTTTAAGAT23615984SRR21814509
869GTTGCGGTTTAAGTTCTTAT-AATTCTTACGCCTTTAAGAT511705497SRR13608004
869GTTGCGGTTTAAGTTCTTAT-AATTCTTACGCCTTTAAGAT511827335SRR13608004
870GTTGCGGTTTAAGTTGTTAT-CCTACTTAGGCTTTTAAGAT114363830SRR13608004
870GTTGCGGTTTAAGTTGTTAT-CCTACTTAGGCTTTTAAGAT44003428SRR13608004
870GTTGCGGTTTAAGTTGTTAT-CCTACTTAGGCTTTTAAGAT511651314SRR13608004
871GTTGGTTAGTGTTTTGGAGT-AAGCTTTGAGAAGCAAGAAG512027019SRR13608004
871GTTGGTTAGTGTTTTGGAGT-AAGCTTTGAGAAGCAAGAAG512062799SRR13608004
872GTTGGTTTGTGTTTTGGAGT-CAAAGCTTTGAGAAGCAATA23662437SRR21814507
872GTTGGTTTGTGTTTTGGAGT-CAAAGCTTTGAGAAGCAATA512062799SRR21814507
873GTTTAAGTTCTTATACTCAA-ACTTAGGCTTACAAGATCGG43975725SRR13608004
873GTTTAAGTTCTTATACTCAA-ACTTAGGCTTACAAGATCGG511667525SRR13608004
874GTTTAAGTTCTTATACTCAA-TCTTACGCCTTTAAGATCCG43954149SRR13608004
874GTTTAAGTTCTTATACTCAA-TCTTACGCCTTTAAGATCCG43975725SRR13608004
875GTTTACGTTTTTTGGCGGGA-CGTTTTTGGCGGGAAAATTA17985830SRR13608004
875GTTTACGTTTTTTGGCGGGA-CGTTTTTGGCGGGAAAATTA111286912SRR21814496
876GTTTAGGATTTAGGGTTTAG-AAGTTTAGGGTTTAGGGTTT115092053SRR21814507
876GTTTAGGATTTAGGGTTTAG-AAGTTTAGGGTTTAGGGTTT116293986SRR21814507
877GTTTAGGGTTTAGGGTTTAG-TAAGGGTTTAGGGTTAAGAG115421605SRR21814506
877GTTTAGGGTTTAGGGTTTAG-TAAGGGTTTAGGGTTAAGAG23529926SRR21814506
878GTTTAGGGTTTAGGTTTAAG-TGGTTTAGGGTTTAGGGTTT115160436SRR21814514
878GTTTAGGGTTTAGGTTTAAG-TGGTTTAGGGTTTAGGGTTT115427963SRR21814514
879GTTTTTGGCGAGAAAATCAC-ACGTTTTTGACGGGAAAATT14093932SRR21814516
879GTTTTTGGCGAGAAAATCAC-ACGTTTTTGACGGGAAAATT18276870SRR21814516
880GTTTTTGGCGGGAAAATCAC-GTTTTTGGCGGGAAAATCAC116253371SRR13608004
880GTTTTTGGCGGGAAAATCAC-GTTTTTGGCGGGAAAATCAC311396732SRR21814504
880GTTTTTGGCGGGAAAATCAC-GTTTTTGGCGGGAAAATCAC316353659SRR21814504
881TAAAAATATAACCAAACACT-GTGTTTGGTTATATTTTTAT511228940SRR13608004
881TAAAAATATAACCAAACACT-GTGTTTGGTTATATTTTTAT511228946SRR13608004
882TAAAACCAACAAAAAATTAC-TACTTATACCCATTTTCTCC114683172SRR21814510
882TAAAACCAACAAAAAATTAC-TACTTATACCCATTTTCTCC44013260SRR21814510
883TAAAACCAACAAAAAATTGC-ACCCATTTTCTCACAAAAGA114671484SRR13608004
883TAAAACCAACAAAAAATTGC-ACCCATTTTCTCACAAAAGA44013260SRR13608004
884TAAAACCAACAAAAATTTGC-ACCCATTTTCTCACAAAAGA114671484SRR13608004
884TAAAACCAACAAAAATTTGC-ACCCATTTTCTCACAAAAGA44013260SRR13608004
885TAAAACCAACAAAAATTTGC-TATACCCATTTCCTCCCAAA114888391SRR21814505
885TAAAACCAACAAAAATTTGC-TATACCCATTTCCTCCCAAA44013260SRR13608004
886TAAAACCAACAAACAATTGC-TACCTATTTTCTCCCAAAAG44013260SRR21814501
886TAAAACCAACAAACAATTGC-TACCTATTTTCTCCCAAAAG44059536SRR21814501
887TAAAAGCATAAGTAGTGTTT-TATAACAACTTAAACCGCAA23713260SRR21814501SRR21814502
887TAAAAGCATAAGTAGTGTTT-TATAACAACTTAAACCGCAA43966911SRR13608004
888TAAAAGCCTAAGTAGTGTCT-TATAACAACTTAAACCGCAA23713438SRR13608004
888TAAAAGCCTAAGTAGTGTCT-TATAACAACTTAAACCGCAA43966911SRR13608004
889TAAAAGCCTAAGTAGTGTTT-AAGAACTTAAACCGCAACCC114363647SRR13608004
889TAAAAGCCTAAGTAGTGTTT-AAGAACTTAAACCGCAACCC114511217SRR13608004
889TAAAAGCCTAAGTAGTGTTT-AAGAACTTAAACCGCAACCC511963313SRR13608004
890TAAAAGCCTAAGTAGTGTTT-GAACTTAAACCGCAACCCAA114511217SRR13608004
890TAAAAGCCTAAGTAGTGTTT-GAACTTAAACCGCAACCCAA511963313SRR13608004
891TAAAATGGTCATTAAAAATA-CTAAAACAATTTCCAAATAA114010024SRR21814510
891TAAAATGGTCATTAAAAATA-CTAAAACAATTTCCAAATAA41866939SRR21814510
892TAAAATTCCGGAACCGGGAC-AGCGCGAACTTCGAAAGGGG27979SRR13608004
892TAAAATTCCGGAACCGGGAC-AGCGCGAACTTCGAAAGGGG314201706SRR21814510
893TAAACAACTTTGTTAGTGTT-AACAAAAAATTGGTTAGAAG114887563SRR21814505
893TAAACAACTTTGTTAGTGTT-AACAAAAAATTGGTTAGAAG114959988SRR21814505
894TAAACCCTAAACCCTAAACC-AAACCCTAAACCCTAAACCC115200241SRR21814514
894TAAACCCTAAACCCTAAACC-AAACCCTAAACCCTAAACCC116292983SRR21814514
895TAAACCCTAAACCCTAAACC-CCTAAACCCTAAAACCTAAA115262732SRR21814500
895TAAACCCTAAACCCTAAACC-CCTAAACCCTAAAACCTAAA43194809SRR21814500
895TAAACCCTAAACCCTAAACC-CCTAAACCCTAAAACCTAAA43194816SRR21814500
896TAAACCTAACAAGTGGATTA-TATGAATACCTAATGAGAAA113622144SRR13608004
896TAAACCTAACAAGTGGATTA-TATGAATACCTAATGAGAAA43935267SRR13608004
897TAAAGGCGTAAGAATTGTAT-AGTATAAGACTTAAACCGCA43954137SRR13608004
897TAAAGGCGTAAGAATTGTAT-AGTATAAGACTTAAACCGCA43965808SRR21814512
898TAAATACTGAATACTGAATA-TAAACAAAATCAAGAACAAA113777212SRR21814519
898TAAATACTGAATACTGAATA-TAAACAAAATCAAGAACAAA23683418SRR21814519
899TAAATAGATTTGTTAGTGTT-AAACCAAAAAAACTTGCTTA114933404SRR13608004
899TAAATAGATTTGTTAGTGTT-AAACCAAAAAAACTTGCTTA114936256SRR13608004
900TAAATCTTTTAAAGCCCTTT-CTTTAAAAATCTTTAAAAAC116596624SRR21814504
900TAAATCTTTTAAAGCCCTTT-CTTTAAAAATCTTTAAAAAC22065724SRR21814504
901TAACCAAGCTTCTTCTTGCT-AGTCATATTTGACTCCAAAA23662072SRR21814495SRR21814500SRR21814501SRR21814506SRR21814507SRR21814508SRR21814513SRR21814515SRR21814516
901TAACCAAGCTTCTTCTTGCT-AGTCATATTTGACTCCAAAA43195360SRR13608004
901TAACCAAGCTTCTTCTTGCT-AGTCATATTTGACTCCAAAA43966983SRR21814501
902TAACGCCCGTGAACCGGAAA-AAAATGGGTCGGGTTGTTTCATGP1 LTR/Gypsy113415263SRR21814490SRR21814504
902TAACGCCCGTGAACCGGAAA-AAAATGGGTCGGGTTGTTTCATGP1 LTR/Gypsy123197636SRR21814490SRR21814504
903TAACGCTTGAAACCACAACC-CGCTAAACCAGTCGTTCAAA113640174SRR13608004
903TAACGCTTGAAACCACAACC-CGCTAAACCAGTCGTTCAAA42649981SRR13608004
904TAACTATAGAATTGAAAAGA-TTCTTTTCAATTCTATAGTT27150176SRR21814517
904TAACTATAGAATTGAAAAGA-TTCTTTTCAATTCTATAGTT27150180SRR21814517
905TAAGAAAACATATAAACATA-TCGATCAAATTAAAGTATCC42060905SRR21814495
905TAAGAAAACATATAAACATA-TCGATCAAATTAAAGTATCC512872734SRR13608004
906TAAGATCAATCGATCTTCTT-CGATCTTCTTCTTCTTCTTC113738059SRR21814510
906TAAGATCAATCGATCTTCTT-CGATCTTCTTCTTCTTCTTC319039815SRR21814510
907TAAGGGAATTTAATGAAAAA-TTTTTTCATTAAATTCCCTT511025290SRR21814517
907TAAGGGAATTTAATGAAAAA-TTTTTTCATTAAATTCCCTT511025292SRR21814517
908TAAGGGTTAATTTGCAAACT-ACTATTTTGCCAACACACCC124428675SRR21814492SRR21814493
908TAAGGGTTAATTTGCAAACT-ACTATTTTGCCAACACACCC215348090SRR21814492SRR21814493
909TAAGTGACGACTGAGATATG-CATATCTCAGTCGTCACTTA210607016SRR13608004
909TAAGTGACGACTGAGATATG-CATATCTCAGTCGTCACTTA210607022SRR13608004
910TAATAAATTGATTAACAAAC-GACTTTTAATTATTGATTTT112183890SRR21814513
910TAATAAATTGATTAACAAAC-GACTTTTAATTATTGATTTT116859076SRR21814513
911TAATACACATGACATCAAGT-AGGTTTAAGTTCTTATACTC511736733SRR13608004
911TAATACACATGACATCAAGT-AGGTTTAAGTTCTTATACTC511958208SRR13608004
912TAATCCATATCTAACTCTTA-TATAAATGTTGTCTAAACAC114890024SRR21814516
912TAATCCATATCTAACTCTTA-TATAAATGTTGTCTAAACAC44056131SRR21814516
913TAATCCATCTCTAACTCTTA-GGGTATAAGTGTTGTCTAAA114603180SRR13608004
913TAATCCATCTCTAACTCTTA-GGGTATAAGTGTTGTCTAAA44015669SRR21814489
914TAATCTACTTTTTTATATAA-ACATATTAAGAAATCATAAA110851393SRR21814503
914TAATCTACTTTTTTATATAA-ACATATTAAGAAATCATAAA110851394SRR13608004
915TAATGTAAACCAAGATAGAT-AGGAAATATGCCCTGCATCA12646479SRR13608004
915TAATGTAAACCAAGATAGAT-AGGAAATATGCCCTGCATCA41175953SRR21814498
916TAATGTCTGTCTCTTATACA-ATGTGTATAAGAGACAGACA128244732SRR13608004
916TAATGTCTGTCTCTTATACA-ATGTGTATAAGAGACAGACA210603838SRR13608004
916TAATGTCTGTCTCTTATACA-ATGTGTATAAGAGACAGACA57704269SRR13608004
917TAATTAGCTTGCCAAAAACA-TTCCCGCCAAAAACGTAAAC110526768SRR13608004
917TAATTAGCTTGCCAAAAACA-TTCCCGCCAAAAACGTAAAC29314868SRR13608004
918TAATTAGTCAAATGCATTAG-CCTAATCCATCTCTAACTCT114927268SRR21814517
918TAATTAGTCAAATGCATTAG-CCTAATCCATCTCTAACTCT44055833SRR21814517
919TAATTTTCCCGCAAAAAACG-TTTTTCCGCCAAAAACGTAA110526908SRR13608004
919TAATTTTCCCGCAAAAAACG-TTTTTCCGCCAAAAACGTAA121210540SRR21814490
920TAATTTTCCCGCCAAAAACG-TCCCGCCAAAAAACGTAAAC17985832SRR13608004
920TAATTTTCCCGCCAAAAACG-TCCCGCCAAAAAACGTAAAC111286910SRR21814496
921TACAAAATTAGGGTTTAAGA-TCTTAAACCCTAATTTTGTA116232610SRR13608004
921TACAAAATTAGGGTTTAAGA-TCTTAAACCCTAATTTTGTA116232612SRR13608004
922TACAAAGCCAAATACTCATA-AAGCCTAAGTAGTGTTTCCT43039763SRR21814515
922TACAAAGCCAAATACTCATA-AAGCCTAAGTAGTGTTTCCT511726339SRR21814515
923TACACAATCAAAGCTTTGAG-ACAAAGCGAAAGACTCATAC511755617SRR13608004
923TACACAATCAAAGCTTTGAG-ACAAAGCGAAAGACTCATAC512043486SRR13608004
924TACACATGAGATCAAGTCAT-TTTCTAGTTCTTATACTCAA115600364SRR21814514
924TACACATGAGATCAAGTCAT-TTTCTAGTTCTTATACTCAA42942288SRR21814514
925TACATTTATCAAAGAATATA-TATATATTCTTTGATAAATG124351482SRR13608004
925TACATTTATCAAAGAATATA-TATATATTCTTTGATAAATG124351487SRR13608004
926TACATTTATCAAAGAATATA-TATATTCTTTGATAAATGTA124351482SRR13608004
926TACATTTATCAAAGAATATA-TATATTCTTTGATAAATGTA124351487SRR13608004
927TACCTCATGAAACTGCTTCT-AGAAGCAGTTTCATGAGGTA12534021SRR13608004
927TACCTCATGAAACTGCTTCT-AGAAGCAGTTTCATGAGGTA12534030SRR13608004
928TACCTTAGGGGAAGGTGAGT-TACTCACCTTCCCCTAAGGT320201581SRR13608004
928TACCTTAGGGGAAGGTGAGT-TACTCACCTTCCCCTAAGGT320201583SRR13608004
929TACGACTTGATGTCATGTGT-AGCTTGGTTAGTGTTTTGGA23713835SRR13608004
929TACGACTTGATGTCATGTGT-AGCTTGGTTAGTGTTTTGGA511856310SRR13608004
930TACGGTTTAAGTTCTTATAA-TCACTACTTAGGCTTTTAAG23615983SRR21814510
930TACGGTTTAAGTTCTTATAA-TCACTACTTAGGCTTTTAAG43965816SRR21814510
931TACGGTTTAAGTTGTTATAC-AGACTTAGGCTTTTAAGATC23624397SRR13608004
931TACGGTTTAAGTTGTTATAC-AGACTTAGGCTTTTAAGATC43951298SRR13608004
931TACGGTTTAAGTTGTTATAC-AGACTTAGGCTTTTAAGATC511734087SRR13608004
932TACGGTTTAGGGTTTAGGGT-TTTAGGGTTTAGGGTTTAGG115148608SRR21814506
932TACGGTTTAGGGTTTAGGGT-TTTAGGGTTTAGGGTTTAGG115149004SRR21814506
933TACTCAATCATACACATGAC-TCGGCTTGCGGTTTAAGTTC114364027SRR13608004
933TACTCAATCATACACATGAC-TCGGCTTGCGGTTTAAGTTC43977517SRR21814506
934TACTCGAAATCTTTGCCACC-GTGGCAAAGATTTCGAGTAG22607SRR13608004
934TACTCGAAATCTTTGCCACC-GTGGCAAAGATTTCGAGTAG22617SRR13608004
935TACTCGATCTCTAGGCCATC-TGATGGCCTAGAGATCGAGT23970507SRR21814514
935TACTCGATCTCTAGGCCATC-TGATGGCCTAGAGATCGAGT23970515SRR21814514
936TACTCTCCATCCCCAAAGGT-TCTACAGCTCCCCACCACCA320202556SRR13608004
936TACTCTCCATCCCCAAAGGT-TCTACAGCTCCCCACCACCA52036799SRR13608004
937TACTGTTATGAATAAAGATG-CTCTTTCTCTGTTTATAACA117031085SRR21814489
937TACTGTTATGAATAAAGATG-CTCTTTCTCTGTTTATAACA48758043SRR21814489
938TACTTAGGCTTTTAAGATCC-GGCTTTGTATCTTCTAACAA114363632SRR21814517
938TACTTAGGCTTTTAAGATCC-GGCTTTGTATCTTCTAACAA511669275SRR21814517
938TACTTAGGCTTTTAAGATCC-GGCTTTGTATCTTCTAACAA511827534SRR21814517
939TACTTTAGCTTCCGGAATCC-CCCAAACTTTAAAACCTAAA115170809SRR13608004
939TACTTTAGCTTCCGGAATCC-CCCAAACTTTAAAACCTAAA115290946SRR21814490
940TAGAAGTCTAAAGACGAGTT-ACTCGTCTTTAGACTTCTAC313584349SRR13608004
940TAGAAGTCTAAAGACGAGTT-ACTCGTCTTTAGACTTCTAC313584357SRR13608004
941TAGAATATGACTTGATGTCA-AAGAAAGTTGGTTAGTGTTT43979866SRR13608004
941TAGAATATGACTTGATGTCA-AAGAAAGTTGGTTAGTGTTT511728201SRR13608004
942TAGAATTCTTAGGGATGGGA-GCATGTTATCTGAGTAGTGA114834049SRR21814496
942TAGAATTCTTAGGGATGGGA-GCATGTTATCTGAGTAGTGA24176234SRR13608004
943TAGCATAAAACACAAAGCTA-TGTAGCTTTGTGTTTTATGC115158680SRR13608004
943TAGCATAAAACACAAAGCTA-TGTAGCTTTGTGTTTTATGC115158686SRR13608004
944TAGCATCGAGCCATTTTTTC-GAAAAAATGGCTCGATGCTA112668928SRR13608004
944TAGCATCGAGCCATTTTTTC-GAAAAAATGGCTCGATGCTA112668935SRR13608004
945TAGCTCTTGCTCCAAAATGT-ATCGTCCTTAGCTTCCTTTT43334220SRR21814504
945TAGCTCTTGCTCCAAAATGT-ATCGTCCTTAGCTTCCTTTT511973943SRR21814504
946TAGCTTCTCAAAGCTTTCAT-CCAAAACACTAACCAACATT42978774SRR13608004
946TAGCTTCTCAAAGCTTTCAT-CCAAAACACTAACCAACATT44010817SRR21814503
946TAGCTTCTCAAAGCTTTCAT-CCAAAACACTAACCAACATT511963048SRR13608004
947TAGGATTTTTAGTAATTAAA-GTTTTATTACTAAAAACCCT29757877SRR21814510SRR21814511
947TAGGATTTTTAGTAATTAAA-GTTTTATTACTAAAAACCCT311240532SRR21814510SRR21814511
948TAGGCCTGGGAGTTCGGAAG-ATAACCGAACCCCCAGGCCT5218149SRR21814504
948TAGGCCTGGGAGTTCGGAAG-ATAACCGAACCCCCAGGCCT513252843SRR21814504
949TAGGCCTGGGCAAAATACCC-TACCCAAACGCCCAGGACTAATHAT3 DNA/HAT16995621SRR21814502
949TAGGCCTGGGCAAAATACCC-TACCCAAACGCCCAGGACTAATHAT3 DNA/HAT127597828SRR21814507
949TAGGCCTGGGCAAAATACCC-TACCCAAACGCCCAGGACTAATHAT3 DNA/HAT219015070SRR21814492
949TAGGCCTGGGCAAAATACCC-TACCCAAACGCCCAGGACTAATHAT3 DNA/HAT45395080SRR21814502SRR21814504
949TAGGCCTGGGCAAAATACCC-TACCCAAACGCCCAGGACTAATHAT3 DNA/HAT46545817SRR21814507
949TAGGCCTGGGCAAAATACCC-TACCCAAACGCCCAGGACTAATHAT3 DNA/HAT416698141SRR21814494
949TAGGCCTGGGCAAAATACCC-TACCCAAACGCCCAGGACTAATHAT3 DNA/HAT52440404SRR21814494SRR21814504
949TAGGCCTGGGCAAAATACCC-TACCCAAACGCCCAGGACTAATHAT3 DNA/HAT521775574SRR21814504
949TAGGCCTGGGCAAAATACCC-TACCCAAACGCCCAGGACTAATHAT3 DNA/HAT526716307SRR21814492
950TAGGGAAAAAACCCGAAAAA-TTTTTTCGGGTTTTTTCCCT2313960SRR21814498
950TAGGGAAAAAACCCGAAAAA-TTTTTTCGGGTTTTTTCCCT2313965SRR21814498
951TAGGGGTGTCAAAATGGGTA-GACCCATTTTGACACCCCTA17537096SRR21814487SRR21814501SRR21814506SRR21814516
951TAGGGGTGTCAAAATGGGTA-GACCCATTTTGACACCCCTA112898978SRR21814509SRR21814516
951TAGGGGTGTCAAAATGGGTA-GACCCATTTTGACACCCCTA113981604SRR21814514
951TAGGGGTGTCAAAATGGGTA-GACCCATTTTGACACCCCTA117491466SRR21814507
951TAGGGGTGTCAAAATGGGTA-GACCCATTTTGACACCCCTA119721628SRR21814506SRR21814514
951TAGGGGTGTCAAAATGGGTA-GACCCATTTTGACACCCCTA130168815SRR21814509
951TAGGGGTGTCAAAATGGGTA-GACCCATTTTGACACCCCTA26384829SRR21814487
951TAGGGGTGTCAAAATGGGTA-GACCCATTTTGACACCCCTA28725464SRR21814507
951TAGGGGTGTCAAAATGGGTA-GACCCATTTTGACACCCCTA210666595SRR21814495
951TAGGGGTGTCAAAATGGGTA-GACCCATTTTGACACCCCTA314963018SRR21814501SRR21814509
951TAGGGGTGTCAAAATGGGTA-GACCCATTTTGACACCCCTA317589924SRR21814509
951TAGGGGTGTCAAAATGGGTA-GACCCATTTTGACACCCCTA412947127SRR21814495
952TAGGGGTGTCAAAATGGGTC-CCCATTTTGACACCCCTAAG111737328SRR21814513
952TAGGGGTGTCAAAATGGGTC-CCCATTTTGACACCCCTAAG56665464SRR21814513
953TAGGGGTGTCAAAATGGGTC-TACCCATTTTGACACCCCTASIMPLEHAT2 DNA/HAT17537103SRR21814506SRR21814516
953TAGGGGTGTCAAAATGGGTC-TACCCATTTTGACACCCCTASIMPLEHAT2 DNA/HAT112898985SRR21814509SRR21814516
953TAGGGGTGTCAAAATGGGTC-TACCCATTTTGACACCCCTASIMPLEHAT2 DNA/HAT113981597SRR21814514
953TAGGGGTGTCAAAATGGGTC-TACCCATTTTGACACCCCTASIMPLEHAT2 DNA/HAT119721635SRR21814506SRR21814514
953TAGGGGTGTCAAAATGGGTC-TACCCATTTTGACACCCCTASIMPLEHAT2 DNA/HAT130168822SRR21814509
953TAGGGGTGTCAAAATGGGTC-TACCCATTTTGACACCCCTASIMPLEHAT2 DNA/HAT314963011SRR21814509
953TAGGGGTGTCAAAATGGGTC-TACCCATTTTGACACCCCTASIMPLEHAT2 DNA/HAT317589931SRR21814509
954TAGGGGTGTCAAAATGGGTC-TTACCCATTTTGACACCCCTSIMPLEHAT2 DNA/HAT17537103SRR21814487SRR21814501
954TAGGGGTGTCAAAATGGGTC-TTACCCATTTTGACACCCCTSIMPLEHAT2 DNA/HAT26384836SRR21814487
954TAGGGGTGTCAAAATGGGTC-TTACCCATTTTGACACCCCTSIMPLEHAT2 DNA/HAT314963011SRR21814501
955TAGGGTAAATTGCAGGCCAC-CTTTTGTGAAAATTTCTTTT119229746SRR21814488
955TAGGGTAAATTGCAGGCCAC-CTTTTGTGAAAATTTCTTTT317352904SRR21814488
956TAGGGTGATTTGCAGATATA-GTTAGTTTTGCCAATTCCCC112938757SRR21814501SRR21814515
956TAGGGTGATTTGCAGATATA-GTTAGTTTTGCCAATTCCCC22175140SRR21814501SRR21814515
957TAGGGTTTTTAGTAATAAAA-GTTTAATTACTAAAAATCCT213621901SRR21814514
957TAGGGTTTTTAGTAATAAAA-GTTTAATTACTAAAAATCCT411227985SRR21814514
958TAGGTGTGTAATAAGAATCA-TATTATTTGATGAGTCTGGT115586350SRR21814506
958TAGGTGTGTAATAAGAATCA-TATTATTTGATGAGTCTGGT312102262SRR21814506
959TAGTATGAAGTGCTACTCGA-AGGGGAAGGTTTAAAAAACC22931SRR21814514
959TAGTATGAAGTGCTACTCGA-AGGGGAAGGTTTAAAAAACC22936SRR13608004
960TAGTCAAATGCATTGGATTG-CTCCTAATCCATCTTTAACT114680102SRR21814505
960TAGTCAAATGCATTGGATTG-CTCCTAATCCATCTTTAACT44055837SRR13608004
961TAGTCATGTTAATATGGGCT-AACCCATTTTAACATCACTA116664641SRR21814492SRR21814493
961TAGTCATGTTAATATGGGCT-AACCCATTTTAACATCACTA120942477SRR21814492SRR21814493SRR21814495SRR21814517
961TAGTCATGTTAATATGGGCT-AACCCATTTTAACATCACTA312976411SRR21814495SRR21814517
962TAGTCCTGGGCGTTTGGGTA-GGGTATTTTGCCCAGGCCTA16995614SRR21814502
962TAGTCCTGGGCGTTTGGGTA-GGGTATTTTGCCCAGGCCTA127597821SRR21814507
962TAGTCCTGGGCGTTTGGGTA-GGGTATTTTGCCCAGGCCTA219015077SRR21814492
962TAGTCCTGGGCGTTTGGGTA-GGGTATTTTGCCCAGGCCTA45395073SRR21814502SRR21814504
962TAGTCCTGGGCGTTTGGGTA-GGGTATTTTGCCCAGGCCTA46545810SRR21814507
962TAGTCCTGGGCGTTTGGGTA-GGGTATTTTGCCCAGGCCTA416698148SRR21814494
962TAGTCCTGGGCGTTTGGGTA-GGGTATTTTGCCCAGGCCTA52440397SRR21814494SRR21814504
962TAGTCCTGGGCGTTTGGGTA-GGGTATTTTGCCCAGGCCTA521775581SRR21814504
962TAGTCCTGGGCGTTTGGGTA-GGGTATTTTGCCCAGGCCTA526716314SRR21814492
963TAGTGATGTTAAAATGGGTT-TTAGCCCATATTAACATGAC116664648SRR21814492SRR21814493
963TAGTGATGTTAAAATGGGTT-TTAGCCCATATTAACATGAC120942470SRR21814492SRR21814493SRR21814495SRR21814517
963TAGTGATGTTAAAATGGGTT-TTAGCCCATATTAACATGAC312976404SRR21814495SRR21814517
964TAGTGATGTTAACTTGGGCA-AGCCCATATTAACATCACTA41511252SRR21814497
964TAGTGATGTTAACTTGGGCA-AGCCCATATTAACATCACTA515446012SRR21814497
965TAGTGATGTTAACTTGGGCA-GCCCATATTAACATCACTAG112940381SRR21814516
965TAGTGATGTTAACTTGGGCA-GCCCATATTAACATCACTAG128085477SRR21814506
965TAGTGATGTTAACTTGGGCA-GCCCATATTAACATCACTAG39629828SRR21814506
965TAGTGATGTTAACTTGGGCA-GCCCATATTAACATCACTAG41511252SRR21814516
966TAGTGATGTTAATATGGGCT-TGCCCAAGTTAACATCACTA112940374SRR21814516
966TAGTGATGTTAATATGGGCT-TGCCCAAGTTAACATCACTA128085470SRR21814506
966TAGTGATGTTAATATGGGCT-TGCCCAAGTTAACATCACTA39629821SRR21814506
966TAGTGATGTTAATATGGGCT-TGCCCAAGTTAACATCACTA41511259SRR21814497SRR21814516
966TAGTGATGTTAATATGGGCT-TGCCCAAGTTAACATCACTA515446005SRR21814497
967TAGTGTTTTGGAGTCGAATA-AAAGCTTTGAGAAGCTAGAA115083595SRR21814511
967TAGTGTTTTGGAGTCGAATA-AAAGCTTTGAGAAGCTAGAA115599621SRR13608004
968TAGTGTTTTGGAGTCGAATA-AAGCTTTGAGAAGCAAGAAG115437705SRR13608004
968TAGTGTTTTGGAGTCGAATA-AAGCTTTGAGAAGCAAGAAG511669356SRR21814512
969TAGTTTAGAGATTTCGTCTA-AAGTTCTTGGGAATCACCAT314493232SRR21814505
969TAGTTTAGAGATTTCGTCTA-AAGTTCTTGGGAATCACCAT511479869SRR21814505
970TAGTTTGTAAATTTCAGAAT-TAGATTAGGTTTTTTTGAAT512872364SRR13608004
970TAGTTTGTAAATTTCAGAAT-TAGATTAGGTTTTTTTGAAT512886210SRR13608004
971TATAAAGGTTTATAGAAGTG-GATGATTGATATCCTTAATA27758282SRR21814496
971TATAAAGGTTTATAGAAGTG-GATGATTGATATCCTTAATA39172822SRR21814496
972TATAACAACTTAAACCGCAA-GACTTGATGTCATGTGTATG42920276SRR21814498
972TATAACAACTTAAACCGCAA-GACTTGATGTCATGTGTATG43041429SRR21814498
972TATAACAACTTAAACCGCAA-GACTTGATGTCATGTGTATG511756592SRR13608004
973TATAAGAACTTAAACCACAA-TAGATGTCATGTGTATGATT43025417SRR21814493
973TATAAGAACTTAAACCACAA-TAGATGTCATGTGTATGATT43042557SRR21814493
974TATAAGAACTTAAACCGCAA-ATATGACTTGATGTCATGTG511731436SRR21814505
974TATAAGAACTTAAACCGCAA-ATATGACTTGATGTCATGTG512028662SRR13608004
975TATACGACTATGTTATGACT-TTTTAGTCATAACATAGTCG113735147SRR13608004
975TATACGACTATGTTATGACT-TTTTAGTCATAACATAGTCG113735150SRR13608004
976TATACTCAATCATACACATG-ATAAGATTGCAGTTTAAGTT115587425SRR13608004
976TATACTCAATCATACACATG-ATAAGATTGCAGTTTAAGTT43966009SRR13608004
977TATAGATGTTTATAGAAGAG-TATCAATCATATCCTCAATA25845848SRR21814486
977TATAGATGTTTATAGAAGAG-TATCAATCATATCCTCAATA41470780SRR21814486
977TATAGATGTTTATAGAAGAG-TATCAATCATATCCTCAATA515034110SRR21814507
977TATAGATGTTTATAGAAGAG-TATCAATCATATCCTCAATA522466794SRR21814507
978TATAGGGTAAATTGCAGGCC-TTTTGTGAAAATTTCTTTTA119229748SRR21814495
978TATAGGGTAAATTGCAGGCC-TTTTGTGAAAATTTCTTTTA26693729SRR21814495
979TATAGTATTGAAGGCTGAAT-CTTTACTTATATACTCTACA119057025SRR21814513
979TATAGTATTGAAGGCTGAAT-CTTTACTTATATACTCTACA2616540SRR21814498
979TATAGTATTGAAGGCTGAAT-CTTTACTTATATACTCTACA310880356SRR21814513
979TATAGTATTGAAGGCTGAAT-CTTTACTTATATACTCTACA42693540SRR21814498
980TATATTGTTAGTACGCTAAA-TTTTAGCGTACTAACAATAT112614757SRR13608004
980TATATTGTTAGTACGCTAAA-TTTTAGCGTACTAACAATAT112614765SRR13608004
981TATCAAAGCTTTGATGGTGT-AAAACACTAACCAAGCTTCT23713870SRR13608004
981TATCAAAGCTTTGATGGTGT-AAAACACTAACCAAGCTTCT511958503SRR13608004
982TATCATAATTATATTTCCGG-CCGGAAATATAATTATGATA113311408SRR13608004
982TATCATAATTATATTTCCGG-CCGGAAATATAATTATGATA113311412SRR13608004
983TATCATGTGTATGATTGAGT-ATTTGGAGTCGAATATGACT44000981SRR21814505
983TATCATGTGTATGATTGAGT-ATTTGGAGTCGAATATGACT511754441SRR21814505
984TATCCTTGTAAGAAGACACA-ACACGATCTTATAAGCCTAA23618555SRR21814490
984TATCCTTGTAAGAAGACACA-ACACGATCTTATAAGCCTAA511870849SRR21814490
985TATCCTTGTTAGAAGACACA-AGATCTTAAAAGCCTAAGTA23713939SRR21814509
985TATCCTTGTTAGAAGACACA-AGATCTTAAAAGCCTAAGTA43978365SRR13608004
986TATCTTCTAACAACGAAACA-CAAAGTCCGTATGAGTCTTT42945381SRR21814517
986TATCTTCTAACAACGAAACA-CAAAGTCCGTATGAGTCTTT43975499SRR13608004
987TATCTTGTGACCCAACACTA-TGTCAACCTCTATACCCTTT114232172SRR21814493
987TATCTTGTGACCCAACACTA-TGTCAACCTCTATACCCTTT313954404SRR21814493
988TATGAATCTTTGGCTTTGTA-TTTCATAGTGTAGCCAAAGT511723622SRR21814505
988TATGAATCTTTGGCTTTGTA-TTTCATAGTGTAGCCAAAGT512045785SRR21814505
989TATGACTTGATCTCATGTGT-AAGAAGATTGGTTAGTGTTT313589011SRR21814517
989TATGACTTGATCTCATGTGT-AAGAAGATTGGTTAGTGTTT511879476SRR13608004
990TATGAGTCTTTGGCTTTGTA-TCAAAGCTTTGATTGTGTAG115093491SRR13608004
990TATGAGTCTTTGGCTTTGTA-TCAAAGCTTTGATTGTGTAG512029099SRR13608004
991TATGAGTCTTTGGCTTTGTA-TTTGATGGTTTAGCCAAAGT44000168SRR21814487
991TATGAGTCTTTGGCTTTGTA-TTTGATGGTTTAGCCAAAGT512045785SRR13608004
992TATGAGTCTTTGTCTTTGTA-AAAGCTTTGATGGTGTAGCC511756852SRR21814501
992TATGAGTCTTTGTCTTTGTA-AAAGCTTTGATGGTGTAGCC511824553SRR13608004
993TATGATTAAGTATAAGAACT-AGTAGAATATGACTTGATGT115437214SRR13608004
993TATGATTAAGTATAAGAACT-AGTAGAATATGACTTGATGT511727692SRR13608004
994TATGATTCCTTTTGGTGTTG-CAACACCAAAAGGAATCATA54095241SRR13608004
994TATGATTCCTTTTGGTGTTG-CAACACCAAAAGGAATCATA54095250SRR13608004
995TATGATTGAGTATAAGAACA-GAGTCAAATATGACTTGATG312673455SRR21814505
995TATGATTGAGTATAAGAACA-GAGTCAAATATGACTTGATG313669146SRR13608004
996TATTAAGGATATCAATCATC-TCACTTCTATAAACCTTTATATRE1 LTR/Copia27758278SRR21814496
996TATTAAGGATATCAATCATC-TCACTTCTATAAACCTTTATATRE1 LTR/Copia39172818SRR21814496
997TATTACTTGATGTCATGTGT-AGATTGGTTAGTGTTTTGGA114473325SRR21814515
997TATTACTTGATGTCATGTGT-AGATTGGTTAGTGTTTTGGA44011319SRR13608004
998TATTAGACTGTGGGCTTCCA-GTGGGACATTGTCCCTAATA18509489SRR21814516
998TATTAGACTGTGGGCTTCCA-GTGGGACATTGTCCCTAATA123380117SRR21814516
999TATTAGGGACAATGTCCCAC-GTGGGACATTGTCCCTAATA513881448SRR21814490SRR21814494SRR21814504
999TATTAGGGACAATGTCCCAC-GTGGGACATTGTCCCTAATA513881452SRR21814490SRR21814494SRR21814504
1000TATTAGGGACAATGTCCCAC-TGGAAGCCCACAGTCTAATA18509485SRR21814508SRR21814516
1000TATTAGGGACAATGTCCCAC-TGGAAGCCCACAGTCTAATA123380121SRR21814508SRR21814516
1001TATTAGTCAAGTAACACACA-CTTTTCCGCATATTCTAACA122552501SRR21814516
1001TATTAGTCAAGTAACACACA-CTTTTCCGCATATTCTAACA310017098SRR21814516
1002TATTAGTCAAGTAACACACA-TTTTCCGCATATTCTAACAG13229241SRR21814499SRR21814510SRR21814511
1002TATTAGTCAAGTAACACACA-TTTTCCGCATATTCTAACAG45425788SRR21814499SRR21814510SRR21814511
1003TATTCTTGCTTCTCAAAGCT-CACTCCAAAACACTAACCAA23620588SRR13608004
1003TATTCTTGCTTCTCAAAGCT-CACTCCAAAACACTAACCAA44001016SRR13608004
1004TATTCTTTTTAGAGAGTAAA-TATTTCTGGTATTCTTTCTC113516877SRR21814507
1004TATTCTTTTTAGAGAGTAAA-TATTTCTGGTATTCTTTCTC22466666SRR21814507
1005TATTGAGGATATGATTGATA-TCTCTTCTATAAACATCTAT25845844SRR21814486
1005TATTGAGGATATGATTGATA-TCTCTTCTATAAACATCTAT41470776SRR21814486
1005TATTGAGGATATGATTGATA-TCTCTTCTATAAACATCTAT515034114SRR21814507
1005TATTGAGGATATGATTGATA-TCTCTTCTATAAACATCTAT522466798SRR21814507
1006TATTGATCAAGACTCAAATA-CAATTCCGCATATTCTTTCA111964680SRR21814495
1006TATTGATCAAGACTCAAATA-CAATTCCGCATATTCTTTCA25888797SRR21814498
1006TATTGATCAAGACTCAAATA-CAATTCCGCATATTCTTTCA26044301SRR21814491
1006TATTGATCAAGACTCAAATA-CAATTCCGCATATTCTTTCA3118670SRR21814498
1006TATTGATCAAGACTCAAATA-CAATTCCGCATATTCTTTCA42717110SRR21814491SRR21814495
1006TATTGATCAAGACTCAAATA-CAATTCCGCATATTCTTTCA42818578SRR21814491SRR21814495
1007TATTGATTCAAACTATATAT-GCTTCAAGCTTACTCCAACA316888192SRR21814510SRR21814511
1007TATTGATTCAAACTATATAT-GCTTCAAGCTTACTCCAACA520214301SRR21814510SRR21814511
1008TATTGCTTTCTAATCAACTG-CTAGATTAGTTGTTCTTAAT114178804SRR21814500
1008TATTGCTTTCTAATCAACTG-CTAGATTAGTTGTTCTTAAT311552798SRR21814500
1009TATTGGGACGGATTAAGAAC-AACCATAATACTCAAAACGA114122558SRR13608004
1009TATTGGGACGGATTAAGAAC-AACCATAATACTCAAAACGA43183646SRR13608004
1010TATTGGGGATAGAGTATAAT-ATTATACTCTATCCCCAATA13186591SRR21814505
1010TATTGGGGATAGAGTATAAT-ATTATACTCTATCCCCAATA13186595SRR21814505
1011TATTGTGATAAGGTCGTATA-GTTCAATACCTAATTCTACA18718232SRR21814492SRR21814493SRR21814506SRR21814519
1011TATTGTGATAAGGTCGTATA-GTTCAATACCTAATTCTACA124470191SRR21814506
1011TATTGTGATAAGGTCGTATA-GTTCAATACCTAATTCTACA32654605SRR21814492SRR21814493
1011TATTGTGATAAGGTCGTATA-GTTCAATACCTAATTCTACA513859850SRR21814519
1012TATTTAAAAACAACACATGT-ACATGTGTTGTTTTTAAATA113285125SRR13608004
1012TATTTAAAAACAACACATGT-ACATGTGTTGTTTTTAAATA113285130SRR13608004
1013TATTTAAAAACAACACATGT-TTACATGTGTTGTTTTTAAA113285125SRR13608004
1013TATTTAAAAACAACACATGT-TTACATGTGTTGTTTTTAAA113285130SRR13608004
1014TCAAACCTCACCTCCAGCTT-TGGTGCTTTGGCTCTGAGTC114246476SRR13608004
1014TCAAACCTCACCTCCAGCTT-TGGTGCTTTGGCTCTGAGTC512023115SRR13608004
1015TCAAAGCTTTGAGAAGCAAG-TCATACGGACTTCGGCTACA511956783SRR13608004
1015TCAAAGCTTTGAGAAGCAAG-TCATACGGACTTCGGCTACA511974481SRR13608004
1016TCAAAGCTTTGAGAAGCAAG-TCATACGGACTTTGGCTACA114484274SRR21814505
1016TCAAAGCTTTGAGAAGCAAG-TCATACGGACTTTGGCTACA42965917SRR21814505
1017TCAAAGCTTTGAGAAGCAAG-TCATATGGACTTCGGCTAAA114484274SRR21814498
1017TCAAAGCTTTGAGAAGCAAG-TCATATGGACTTCGGCTAAA511974481SRR13608004
1017TCAAAGCTTTGAGAAGCAAG-TCATATGGACTTCGGCTAAA512060819SRR13608004
1018TCAAATGCATTAGATTGTGA-TTAATCCATCTCTAACTCTT114745192SRR21814500
1018TCAAATGCATTAGATTGTGA-TTAATCCATCTCTAACTCTT114935405SRR21814500
1019TCAAATTTTCCGGTTTAGCT-AGCTAAACCGGAAAATTTGA322118282SRR13608004
1019TCAAATTTTCCGGTTTAGCT-AGCTAAACCGGAAAATTTGA322118285SRR13608004
1020TCAAATTTTTATGGTTTTTT-TTTTGTGAAATAATTTTCTG114217842SRR21814487SRR21814491SRR21814518
1020TCAAATTTTTATGGTTTTTT-TTTTGTGAAATAATTTTCTG312305100SRR13608004
1021TCAACAACAACAACAACAAG-ACAACAACAACAACAACAAC18244372SRR21814503
1021TCAACAACAACAACAACAAG-ACAACAACAACAACAACAAC25469592SRR21814503
1021TCAACAACAACAACAACAAG-ACAACAACAACAACAACAAC319207650SRR21814503
1022TCAACGAGTTCACACCTTGG-GGGCCGCACGCGCGCTACAC25187SRR13608004
1022TCAACGAGTTCACACCTTGG-GGGCCGCACGCGCGCTACAC514253556SRR13608004
1023TCAAGAATTTTTCCAAGTTC-CTATTCACAAGACTAGATTT23609105SRR21814487
1023TCAAGAATTTTTCCAAGTTC-CTATTCACAAGACTAGATTT23628461SRR21814487
1024TCAATGGATATTACATGCAT-GATGCATGTAATATCCATTG416630785SRR13608004
1024TCAATGGATATTACATGCAT-GATGCATGTAATATCCATTG416630790SRR13608004
1025TCAATTAATCCCTAAAACAC-ATCTATGATAGTAGGATTTT114234348SRR13608004
1025TCAATTAATCCCTAAAACAC-ATCTATGATAGTAGGATTTT24593663SRR21814520
1026TCACTACAAGAAAACAGACA-ACGCCTGTTTTCTTGTAGTG312971041SRR21814509
1026TCACTACAAGAAAACAGACA-ACGCCTGTTTTCTTGTAGTG45089195SRR21814509
1027TCACTACAAGAAAACAGGTG-TTGTCTGTTTTCTTGTAGTG28099375SRR21814518
1027TCACTACAAGAAAACAGGTG-TTGTCTGTTTTCTTGTAGTG45125759SRR21814487
1027TCACTACAAGAAAACAGGTG-TTGTCTGTTTTCTTGTAGTG515558531SRR21814518
1027TCACTACAAGAAAACAGGTG-TTGTCTGTTTTCTTGTAGTG516517823SRR21814487
1028TCAGAAGCTAACCTCTCAGC-GCTGAGAGGTTAGCTTCTGA315535935SRR13608004
1028TCAGAAGCTAACCTCTCAGC-GCTGAGAGGTTAGCTTCTGA315535942SRR13608004
1029TCAGCTACACCATCAAAGCT-TACAAAGACAAAGACTCATA43966674SRR13608004
1029TCAGCTACACCATCAAAGCT-TACAAAGACAAAGACTCATA511822955SRR13608004
1029TCAGCTACACCATCAAAGCT-TACAAAGACAAAGACTCATA512048194SRR13608004
1030TCAGTGTTTTCACGCCCGAC-GGTCGGGTTTCAAAACATTG3188167SRR21814507
1030TCAGTGTTTTCACGCCCGAC-GGTCGGGTTTCAAAACATTG51871380SRR21814507
1031TCAGTGTTTTCACGCCCGAC-GGTCGGTTTTAAAAACATTG216446911SRR21814501
1031TCAGTGTTTTCACGCCCGAC-GGTCGGTTTTAAAAACATTG57422110SRR21814501
1031TCAGTGTTTTCACGCCCGAC-GGTCGGTTTTAAAAACATTG59712793SRR21814501
1032TCAGTTGGTGTGAATTATGA-TTCATAATTCACACCAACTG22389121SRR13608004
1032TCAGTTGGTGTGAATTATGA-TTCATAATTCACACCAACTG22389126SRR13608004
1033TCATAAAAGCCTAAGTAGTG-GAGTATAAGAACTTAAACCA23615632SRR21814520
1033TCATAAAAGCCTAAGTAGTG-GAGTATAAGAACTTAAACCA43955921SRR13608004
1034TCATAAAGTTTTAACAAAAA-CTCACGGTATAAAAATTATA511316325SRR13608004
1034TCATAAAGTTTTAACAAAAA-CTCACGGTATAAAAATTATA512826928SRR21814505
1035TCATACGGACTTCGGCTACA-TCCTTGTTAGAAGATACAAA511674936SRR13608004
1035TCATACGGACTTCGGCTACA-TCCTTGTTAGAAGATACAAA511757556SRR13608004
1036TCATACTCGACCACCCAGTT-CAATTCTTTACTGTTACTCG115704297SRR21814510
1036TCATACTCGACCACCCAGTT-CAATTCTTTACTGTTACTCG43128760SRR13608004
1037TCATATGTGGCAATTCCACC-GGTGGAATTGCCACATATGA41586293SRR13608004
1037TCATATGTGGCAATTCCACC-GGTGGAATTGCCACATATGA41586301SRR13608004
1038TCATCAAGTGTATTATTTCC-GGAAATAATACACTTGATGA16542680SRR13608004
1038TCATCAAGTGTATTATTTCC-GGAAATAATACACTTGATGA16542688SRR13608004
1039TCATCATCATCATCATCTTC-CATCATCATCATCATCATCA123207984SRR21814513
1039TCATCATCATCATCATCTTC-CATCATCATCATCATCATCA213297667SRR21814513
1040TCATGTGTATGATTGAATAT-TTTTGGAGTCAAATATTACT115587840SRR13608004
1040TCATGTGTATGATTGAATAT-TTTTGGAGTCAAATATTACT511930739SRR13608004
1041TCCATATGAGTCTTTATCTT-TCAAAGCTTTGATGGTTTAG23615169SRR21814514
1041TCCATATGAGTCTTTATCTT-TCAAAGCTTTGATGGTTTAG43978502SRR13608004
1042TCCATATGAGTCTTTGGCTT-TTCTCAAAGCTTTGATGGTG43034093SRR21814505
1042TCCATATGAGTCTTTGGCTT-TTCTCAAAGCTTTGATGGTG511738425SRR21814505
1042TCCATATGAGTCTTTGGCTT-TTCTCAAAGCTTTGATGGTG511757744SRR21814505
1043TCCATGTAACTGCATTTTAC-TAAAATGCAGTTACATGGAG125308513SRR13608004
1043TCCATGTAACTGCATTTTAC-TAAAATGCAGTTACATGGAG125308521SRR13608004
1044TCCATTGAAGTGTATAGGGG-CCCTATACACTTCAATGGAC26589031SRR13608004
1044TCCATTGAAGTGTATAGGGG-CCCTATACACTTCAATGGAC26589038SRR13608004
1045TCCCTTGAACAAAATGACCA-TTGTCCATTTTTAAAAATAC19586440SRR13608004
1045TCCCTTGAACAAAATGACCA-TTGTCCATTTTTAAAAATAC23014328SRR21814518
1046TCCGCCGTCCTGGTCTACGA-AGGCCGAGGAGTGGTCGAGG21025SRR13608004
1046TCCGCCGTCCTGGTCTACGA-AGGCCGAGGAGTGGTCGAGG314192677SRR13608004
1047TCCGGAAGCCTAAAGTAGGA-ATAAGAACTAGAACCGCAAC115253321SRR13608004
1047TCCGGAAGCCTAAAGTAGGA-ATAAGAACTAGAACCGCAAC43238867SRR21814509
1048TCCGGATCGACGATTCCTCG-AATCCTCGGACCCGGTCGAC210274SRR13608004
1048TCCGGATCGACGATTCCTCG-AATCCTCGGACCCGGTCGAC314191908SRR21814506
1049TCCGTATGAGTCTTTGGCTT-TTTCTCAAAGCTTTGATGGT115149245SRR21814493
1049TCCGTATGAGTCTTTGGCTT-TTTCTCAAAGCTTTGATGGT43046384SRR21814493
1050TCGAATATGACTTGATGTCA-GAAGAAGCTTGGTTAGTGTT43035218SRR21814492
1050TCGAATATGACTTGATGTCA-GAAGAAGCTTGGTTAGTGTT511974704SRR13608004
1051TCGACCAGGACGAGGAATCG-ATCGACCGGGTCCGAGGAAT21470SRR21814503
1051TCGACCAGGACGAGGAATCG-ATCGACCGGGTCCGAGGAAT210263SRR13608004
1052TCGAGTAACAGTAAAGAATT-CAACTGGGTGGTCGAGTATG115704298SRR21814510
1052TCGAGTAACAGTAAAGAATT-CAACTGGGTGGTCGAGTATG43128759SRR13608004
1053TCGGGTCCGAGGAATCGTCG-CGACGATTCCTCGGACCCGA112379270SRR13608004
1053TCGGGTCCGAGGAATCGTCG-CGACGATTCCTCGGACCCGA112379277SRR13608004
1054TCGTCAATGGTGATTGAGTC-GACTCAATCACCATTGACGA24131760SRR13608004
1054TCGTCAATGGTGATTGAGTC-GACTCAATCACCATTGACGA24131768SRR13608004
1055TCTAACAAGAAAACACTACT-CCATATGAGTCTTTGGCTTT115083524SRR21814496
1055TCTAACAAGAAAACACTACT-CCATATGAGTCTTTGGCTTT511796335SRR21814496
1056TCTACACGACGGTGTAGCGT-GAGACGGGGCTAGCTACCCT115569734SRR21814520
1056TCTACACGACGGTGTAGCGT-GAGACGGGGCTAGCTACCCT43835785SRR13608004
1057TCTACCAAAAGAGGCTAAAA-GGTTTAGACAACACTTATAC114681742SRR13608004
1057TCTACCAAAAGAGGCTAAAA-GGTTTAGACAACACTTATAC114935032SRR13608004
1057TCTACCAAAAGAGGCTAAAA-GGTTTAGACAACACTTATAC115016318SRR13608004
1058TCTAGTTGAGGTTCTAGTTT-AAGCACTACTTTACTATTCG115088350SRR13608004
1058TCTAGTTGAGGTTCTAGTTT-AAGCACTACTTTACTATTCG115171856SRR13608004
1059TCTATGATTGAGTATAAGAA-CGAGTCGAATATGACTTGAT115083631SRR21814486
1059TCTATGATTGAGTATAAGAA-CGAGTCGAATATGACTTGAT511790061SRR21814486
1060TCTCAAAGCTTTCATGGTGT-CAAAACACTAACCAAGCTTC42961255SRR21814505
1060TCTCAAAGCTTTCATGGTGT-CAAAACACTAACCAAGCTTC511788768SRR21814505
1060TCTCAAAGCTTTCATGGTGT-CAAAACACTAACCAAGCTTC511898685SRR21814505
1061TCTCAAAGCTTTGATAGTGA-CACTAACCAAGCTTCTTATT115167274SRR13608004
1061TCTCAAAGCTTTGATAGTGA-CACTAACCAAGCTTCTTATT512047873SRR21814513
1062TCTCAAAGCTTTGATGGTGT-CACTAACCAAGCTTCTTATT115167274SRR13608004
1062TCTCAAAGCTTTGATGGTGT-CACTAACCAAGCTTCTTATT23719914SRR21814516
1063TCTCAGGAACTAGTGGATCA-CCAATCCCTTGGGATAGAGA511377492SRR13608004
1063TCTCAGGAACTAGTGGATCA-CCAATCCCTTGGGATAGAGA511831899SRR13608004
1064TCTCCTCCTCCACCCCCGGT-CTCCTCCTCCACCCCCGGTT56693231SRR13608004
1064TCTCCTCCTCCACCCCCGGT-CTCCTCCTCCACCCCCGGTT56693339SRR13608004
1065TCTCCTTCTCCTAAGGTAGT-GCTCCCCACCACCACCATAC18389242SRR13608004
1065TCTCCTTCTCCTAAGGTAGT-GCTCCCCACCACCACCATAC320201980SRR13608004
1066TCTCTAACTCTTATAATTAG-TGTTGTCTAAACACTCATAA114686942SRR13608004
1066TCTCTAACTCTTATAATTAG-TGTTGTCTAAACACTCATAA44056455SRR21814496
1067TCTCTCTCTCTCTCTCTCCC-CTCTCTCTTCTTTCTCTCTC112930258SRR21814503
1067TCTCTCTCTCTCTCTCTCCC-CTCTCTCTTCTTTCTCTCTC112930262SRR13608004
1068TCTCTTATTTGAGGGAGTAA-GGAATTCGACCCTTAAGTGC114208299SRR21814503
1068TCTCTTATTTGAGGGAGTAA-GGAATTCGACCCTTAAGTGC312745990SRR21814503
1069TCTGATACCATTCCATATCA-ATTGCTCTACTCTACCACAC114439947SRR13608004
1069TCTGATACCATTCCATATCA-ATTGCTCTACTCTACCACAC115418332SRR13608004
1070TCTGTAACGACCGCGTCCCG-GTCCGGGACGGGGTCTCACA21392352SRR21814490
1070TCTGTAACGACCGCGTCCCG-GTCCGGGACGGGGTCTCACA59063910SRR21814490
1071TCTGTAACGACCGCGTCCCG-TCCGGGACGGGGTCTCACAC21392352SRR21814516
1071TCTGTAACGACCGCGTCCCG-TCCGGGACGGGGTCTCACAC25486287SRR21814516
1072TCTGTAACGCCCGCGATCCT-TCCGGATCGGGGCCTTTCAG24088SRR21814504
1072TCTGTAACGCCCGCGATCCT-TCCGGATCGGGGCCTTTCAG26209SRR21814504
1072TCTGTAACGCCCGCGATCCT-TCCGGATCGGGGCCTTTCAG29661SRR21814504
1072TCTGTAACGCCCGCGATCCT-TCCGGATCGGGGCCTTTCAG250016SRR21814504
1073TCTTAAAGGCATAAGAATTG-TATAAGAACTTAAACCGCAA512026565SRR21814505
1073TCTTAAAGGCATAAGAATTG-TATAAGAACTTAAACCGCAA512064894SRR21814505
1074TCTTATACTCAATCATACAC-ACGCCTTTAAGATCCGGTTG511667533SRR13608004
1074TCTTATACTCAATCATACAC-ACGCCTTTAAGATCCGGTTG511754824SRR13608004
1075TCTTCTTCTTCACTCTCTTC-ATCTTTCTCTTCTTCTTCTT13993273SRR21814500
1075TCTTCTTCTTCACTCTCTTC-ATCTTTCTCTTCTTCTTCTT113710559SRR21814500
1076TCTTCTTGCTTCTCAAAGCT-ACTCAAAAACACTAACCAAC312672254SRR13608004
1076TCTTCTTGCTTCTCAAAGCT-ACTCAAAAACACTAACCAAC511824594SRR13608004
1077TCTTGACTTACTCTTCTCAC-AGTGAGAAGAGTAAGTCAAG314193352SRR13608004
1077TCTTGACTTACTCTTCTCAC-AGTGAGAAGAGTAAGTCAAG314193356SRR13608004
1077TCTTGACTTACTCTTCTCAC-AGTGAGAAGAGTAAGTCAAG314193360SRR13608004
1078TCTTGCAATCTCTCAAGCTT-AAGCTTGAGAGATTGCAAGA45639198SRR13608004
1078TCTTGCAATCTCTCAAGCTT-AAGCTTGAGAGATTGCAAGA45639205SRR13608004
1079TCTTGTTAAGTTCTTTACTG-ATCTGCCTTTGTTCTATACT113737255SRR13608004
1079TCTTGTTAAGTTCTTTACTG-ATCTGCCTTTGTTCTATACT22718221SRR13608004
1080TCTTTGCTTCTTCAAACGGA-TCCGTTTGAAGAAGCAAAGA417945275SRR13608004
1080TCTTTGCTTCTTCAAACGGA-TCCGTTTGAAGAAGCAAAGA417945282SRR13608004
1081TCTTTGTTCTTTCTTTCTGT-CAGAAAGAAAGAACAAAGAC511621682SRR13608004
1081TCTTTGTTCTTTCTTTCTGT-CAGAAAGAAAGAACAAAGAC511621688SRR13608004
1082TCTTTTGTGAGAAAATGGGT-GCAAATTTTTGTTGGTTTTA114671482SRR13608004
1082TCTTTTGTGAGAAAATGGGT-GCAAATTTTTGTTGGTTTTA44013262SRR13608004
1083TGAAAATCGGGTTATATCAA-TATACCTAAAACATAGATAA313427984SRR21814517
1083TGAAAATCGGGTTATATCAA-TATACCTAAAACATAGATAA44308678SRR13608004
1084TGAAAGAATATGCGGAATTG-TATTTGAGTCTTGATCAATA111964684SRR21814495
1084TGAAAGAATATGCGGAATTG-TATTTGAGTCTTGATCAATA25888793SRR21814498
1084TGAAAGAATATGCGGAATTG-TATTTGAGTCTTGATCAATA26044297SRR21814491
1084TGAAAGAATATGCGGAATTG-TATTTGAGTCTTGATCAATA3118666SRR21814498
1084TGAAAGAATATGCGGAATTG-TATTTGAGTCTTGATCAATA42717106SRR21814491SRR21814495
1084TGAAAGAATATGCGGAATTG-TATTTGAGTCTTGATCAATA42818582SRR21814491SRR21814495
1085TGAAAGGCCCCGATCCGGAC-AGGATCGCGGGCGTTACAGT23146SRR21814513
1085TGAAAGGCCCCGATCCGGAC-AGGATCGCGGGCGTTACAGT22717329SRR21814513
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA19843924SRR21814496SRR21814502
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA112714442SRR21814490SRR21814505
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA112741496SRR21814509
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA116500103SRR21814516
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA24369SRR21814488
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA25229SRR21814488
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA25485SRR21814502
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA25505SRR21814490
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA26356SRR21814502
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA26630SRR21814514
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA27003SRR21814514
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA27170SRR21814514
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA27472SRR21814512
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA27498SRR21814514
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA27792SRR21814506
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA28167SRR21814496
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA29011SRR21814517
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA29077SRR21814501SRR21814514SRR21814516
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA219625SRR21814517
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA220485SRR21814502
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA221451SRR21814514
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA21752122SRR21814495SRR21814517
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA21906267SRR21814499SRR21814514
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA24954902SRR21814501
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA25398835SRR21814488SRR21814490SRR21814512SRR21814516
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA29851252SRR21814505
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA31961598SRR21814501
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA38264364SRR21814520
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA310861146SRR21814502
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA314124732SRR21814506
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA314191713SRR21814509
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA314193386SRR21814488
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA314193394SRR21814502
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA314202186SRR21814505
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA314842555SRR21814499
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA316538068SRR21814505
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA45480120SRR21814501
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA414642293SRR21814495
1086TGAAAGGCCCCGATCCGGAC-TGAGGATCGCGGGCGTTACA514547839SRR21814520
1087TGAAAGGCCCCGATCCGGAC-TTGAGGATCGCGGGCGTTAC24101SRR21814504
1087TGAAAGGCCCCGATCCGGAC-TTGAGGATCGCGGGCGTTAC24112SRR21814504
1087TGAAAGGCCCCGATCCGGAC-TTGAGGATCGCGGGCGTTAC27261SRR21814504
1087TGAAAGGCCCCGATCCGGAC-TTGAGGATCGCGGGCGTTAC28265SRR21814504
1087TGAAAGGCCCCGATCCGGAC-TTGAGGATCGCGGGCGTTAC29663SRR21814504
1087TGAAAGGCCCCGATCCGGAC-TTGAGGATCGCGGGCGTTAC213760SRR21814504
1087TGAAAGGCCCCGATCCGGAC-TTGAGGATCGCGGGCGTTAC221624SRR21814504
1087TGAAAGGCCCCGATCCGGAC-TTGAGGATCGCGGGCGTTAC27191231SRR21814504
1088TGAAATCCTAGAATTGACGG-TACAATTAAATACTACTACG116803875SRR21814490
1088TGAAATCCTAGAATTGACGG-TACAATTAAATACTACTACG116966314SRR21814490
1089TGAACTCCAAAAGCATCCAA-CTGACTTCATGTTCTGTTTT114044578SRR21814509
1089TGAACTCCAAAAGCATCCAA-CTGACTTCATGTTCTGTTTT115569438SRR21814509
1090TGAACTGGATGGGCAGGAAA-TTTCCTGCCCATCCAGTTCA312844518SRR13608004
1090TGAACTGGATGGGCAGGAAA-TTTCCTGCCCATCCAGTTCA312844526SRR13608004
1091TGAAGAATAAAGCCCAATCG-TGAGATTTGATAAAACAACA12965265SRR21814520
1091TGAAGAATAAAGCCCAATCG-TGAGATTTGATAAAACAACA28105648SRR21814520
1091TGAAGAATAAAGCCCAATCG-TGAGATTTGATAAAACAACA219512918SRR21814511
1091TGAAGAATAAAGCCCAATCG-TGAGATTTGATAAAACAACA518202262SRR21814511
1092TGAAGAATTCTACAAATAAC-GAATTAGCATTAAGAACAAT114098130SRR21814512
1092TGAAGAATTCTACAAATAAC-GAATTAGCATTAAGAACAAT115429003SRR21814512
1093TGACATCAAGTCATATTCGA-GTCTTATACTCAATCATACA511664860SRR13608004
1093TGACATCAAGTCATATTCGA-GTCTTATACTCAATCATACA511669503SRR13608004
1094TGACTTGATCTCATGTGTAT-AGCTTGGTTAGTGTTTTGTA511671470SRR13608004
1094TGACTTGATCTCATGTGTAT-AGCTTGGTTAGTGTTTTGTA511825510SRR13608004
1095TGACTTGATGTCATGTGTAA-AAGCTTGGTTAGTGTTTTGG23616470SRR21814495
1095TGACTTGATGTCATGTGTAA-AAGCTTGGTTAGTGTTTTGG43966788SRR21814495
1096TGACTTGATGTCATGTGTAT-AGCTTGGTTAGTGTTTTGGA511668989SRR13608004
1096TGACTTGATGTCATGTGTAT-AGCTTGGTTAGTGTTTTGGA511855065SRR13608004
1097TGAGAGCTCACCTCTTATGC-GGCATAAGTGATAAAAGTTC111959292SRR21814500SRR21814501
1097TGAGAGCTCACCTCTTATGC-GGCATAAGTGATAAAAGTTC312150306SRR21814498SRR21814500SRR21814501SRR21814502
1097TGAGAGCTCACCTCTTATGC-GGCATAAGTGATAAAAGTTC322028065SRR21814502
1097TGAGAGCTCACCTCTTATGC-GGCATAAGTGATAAAAGTTC53472148SRR21814498
1097TGAGAGCTCACCTCTTATGC-GGCATAAGTGATAAAAGTTC57340030SRR21814501
1098TGAGATTAGGAAGTGGTAAA-CCTGCTTTGCTATGTTTCAT114280685SRR13608004
1098TGAGATTAGGAAGTGGTAAA-CCTGCTTTGCTATGTTTCAT116510353SRR21814492SRR21814495
1099TGAGTATAAGAACTTAAACC-AAATATGACTTGATGTCATG43038812SRR21814505
1099TGAGTATAAGAACTTAAACC-AAATATGACTTGATGTCATG512028658SRR13608004
1100TGAGTATAAGAACTTAAACC-ATATGACTTGATGTCATGTG42919560SRR21814500
1100TGAGTATAAGAACTTAAACC-ATATGACTTGATGTCATGTG512028658SRR13608004
1100TGAGTATAAGAACTTAAACC-ATATGACTTGATGTCATGTG512053429SRR13608004
1101TGAGTCTTTGGCTTTGTATG-TTTCATGGTGTAGCCAAAGT115525133SRR13608004
1101TGAGTCTTTGGCTTTGTATG-TTTCATGGTGTAGCCAAAGT512053689SRR13608004
1102TGATAAGCTCAATAGGGTTT-TTGGAGTTTGTTTCTTAACA113254741SRR21814505
1102TGATAAGCTCAATAGGGTTT-TTGGAGTTTGTTTCTTAACA3630482SRR21814504
1102TGATAAGCTCAATAGGGTTT-TTGGAGTTTGTTTCTTAACA318422200SRR21814504SRR21814505
1102TGATAAGCTCAATAGGGTTT-TTGGAGTTTGTTTCTTAACA515365703SRR21814504
1103TGATAAGGTCTGACCCTATC-ACGTCACCCGTAACCTATCA116896355SRR21814499
1103TGATAAGGTCTGACCCTATC-ACGTCACCCGTAACCTATCA117475009SRR21814517
1103TGATAAGGTCTGACCCTATC-ACGTCACCCGTAACCTATCA45560934SRR21814499SRR21814517
1103TGATAAGGTCTGACCCTATC-ACGTCACCCGTAACCTATCA521348990SRR21814517
1104TGATAAGTGTGTATTTTGCA-GACTGAAAAACCTATTATCA113414457SRR21814499SRR21814504SRR21814508SRR21814509SRR21814518
1104TGATAAGTGTGTATTTTGCA-GACTGAAAAACCTATTATCA113776044SRR21814492SRR21814493
1104TGATAAGTGTGTATTTTGCA-GACTGAAAAACCTATTATCA113954184SRR21814504
1104TGATAAGTGTGTATTTTGCA-GACTGAAAAACCTATTATCA23707040SRR21814508
1104TGATAAGTGTGTATTTTGCA-GACTGAAAAACCTATTATCA23909712SRR21814492SRR21814493SRR21814495SRR21814509
1104TGATAAGTGTGTATTTTGCA-GACTGAAAAACCTATTATCA24225673SRR21814499SRR21814510SRR21814518
1104TGATAAGTGTGTATTTTGCA-GACTGAAAAACCTATTATCA43294335SRR21814498
1104TGATAAGTGTGTATTTTGCA-GACTGAAAAACCTATTATCA510607804SRR21814498
1104TGATAAGTGTGTATTTTGCA-GACTGAAAAACCTATTATCA511364948SRR21814495
1104TGATAAGTGTGTATTTTGCA-GACTGAAAAACCTATTATCA512275733SRR21814492
1104TGATAAGTGTGTATTTTGCA-GACTGAAAAACCTATTATCA513390707SRR21814499SRR21814510SRR21814518
1105TGATAAGTGTGTATTTTGCA-GACTTAAAAACCTATTATCA25302006SRR21814488SRR21814500SRR21814506SRR21814512SRR21814513
1105TGATAAGTGTGTATTTTGCA-GACTTAAAAACCTATTATCA510761334SRR21814488SRR21814500SRR21814506SRR21814512SRR21814513
1106TGATAATAGGTTTTTAAGTC-TGCAAAATACACACTTATCA25302002SRR21814488SRR21814500SRR21814506SRR21814512SRR21814513
1106TGATAATAGGTTTTTAAGTC-TGCAAAATACACACTTATCA510761338SRR21814488SRR21814500SRR21814506SRR21814512SRR21814513
1107TGATAATAGGTTTTTAGTCA-TGCAAATTATAGACATATCA116511308SRR21814507
1107TGATAATAGGTTTTTAGTCA-TGCAAATTATAGACATATCA22941821SRR21814514
1107TGATAATAGGTTTTTAGTCA-TGCAAATTATAGACATATCA24670788SRR21814507
1107TGATAATAGGTTTTTAGTCA-TGCAAATTATAGACATATCA312747205SRR21814514
1107TGATAATAGGTTTTTAGTCA-TGCAAATTATAGACATATCA312811241SRR21814514
1107TGATAATAGGTTTTTAGTCA-TGCAAATTATAGACATATCA314158970SRR21814507
1107TGATAATAGGTTTTTAGTCA-TGCAAATTATAGACATATCA411141398SRR21814514
1108TGATAATAGGTTTTTCAGTC-TGCAAAATACACACTTATCA113414461SRR21814499SRR21814504SRR21814508SRR21814509SRR21814515SRR21814518
1108TGATAATAGGTTTTTCAGTC-TGCAAAATACACACTTATCA113954180SRR21814504
1108TGATAATAGGTTTTTCAGTC-TGCAAAATACACACTTATCA23467360SRR21814515
1108TGATAATAGGTTTTTCAGTC-TGCAAAATACACACTTATCA23707044SRR21814508
1108TGATAATAGGTTTTTCAGTC-TGCAAAATACACACTTATCA23909716SRR21814492SRR21814495SRR21814509
1108TGATAATAGGTTTTTCAGTC-TGCAAAATACACACTTATCA24225669SRR21814499SRR21814510SRR21814511SRR21814518
1108TGATAATAGGTTTTTCAGTC-TGCAAAATACACACTTATCA43294339SRR21814498
1108TGATAATAGGTTTTTCAGTC-TGCAAAATACACACTTATCA510607800SRR21814498
1108TGATAATAGGTTTTTCAGTC-TGCAAAATACACACTTATCA511364944SRR21814495
1108TGATAATAGGTTTTTCAGTC-TGCAAAATACACACTTATCA512275729SRR21814492
1108TGATAATAGGTTTTTCAGTC-TGCAAAATACACACTTATCA512369905SRR21814495
1108TGATAATAGGTTTTTCAGTC-TGCAAAATACACACTTATCA513390711SRR21814499SRR21814510SRR21814511SRR21814518
1109TGATACAGGATTAACGTGTG-TCGCAGGTTTCCCTGTAACA24223760SRR21814512SRR21814514
1109TGATACAGGATTAACGTGTG-TCGCAGGTTTCCCTGTAACA316718775SRR21814514
1109TGATACAGGATTAACGTGTG-TCGCAGGTTTCCCTGTAACA45773828SRR21814512SRR21814514
1110TGATAGGTTACGGGTGACGT-GATAGGGTCAGACCTTATCA116896351SRR21814499
1110TGATAGGTTACGGGTGACGT-GATAGGGTCAGACCTTATCA117475013SRR21814517
1110TGATAGGTTACGGGTGACGT-GATAGGGTCAGACCTTATCA45560930SRR21814499SRR21814517
1110TGATAGGTTACGGGTGACGT-GATAGGGTCAGACCTTATCA521348986SRR21814517
1111TGATAGGTTGAAGATACCCT-GTTAGGCTTCGTGCTTAACA310892808SRR21814498
1111TGATAGGTTGAAGATACCCT-GTTAGGCTTCGTGCTTAACA59480263SRR21814498
1112TGATAGTAGGATTTTTGTCA-TGCAAATTATAGACATATCA113485260SRR21814518
1112TGATAGTAGGATTTTTGTCA-TGCAAATTATAGACATATCA114218879SRR21814486SRR21814501SRR21814518
1112TGATAGTAGGATTTTTGTCA-TGCAAATTATAGACATATCA24402327SRR21814486SRR21814501
1112TGATAGTAGGATTTTTGTCA-TGCAAATTATAGACATATCA314167763SRR21814503
1112TGATAGTAGGATTTTTGTCA-TGCAAATTATAGACATATCA314998235SRR21814503
1113TGATATGTCTATAATTTGCA-TGACAAAAATCCTACTATCAATHILA LTR/Gypsy114218883SRR21814486SRR21814501
1113TGATATGTCTATAATTTGCA-TGACAAAAATCCTACTATCAATHILA LTR/Gypsy24402323SRR21814486SRR21814501
1113TGATATGTCTATAATTTGCA-TGACAAAAATCCTACTATCAATHILA LTR/Gypsy314167767SRR21814503
1113TGATATGTCTATAATTTGCA-TGACAAAAATCCTACTATCAATHILA LTR/Gypsy314998239SRR21814503
1114TGATATGTCTATAATTTGCA-TGACTAAAAACCTATTATCAATHILA6A LTR/Gypsy116511312SRR21814507
1114TGATATGTCTATAATTTGCA-TGACTAAAAACCTATTATCAATHILA6A LTR/Gypsy22941825SRR21814514
1114TGATATGTCTATAATTTGCA-TGACTAAAAACCTATTATCAATHILA6A LTR/Gypsy24670792SRR21814507
1114TGATATGTCTATAATTTGCA-TGACTAAAAACCTATTATCAATHILA6A LTR/Gypsy312747201SRR21814514
1114TGATATGTCTATAATTTGCA-TGACTAAAAACCTATTATCAATHILA6A LTR/Gypsy312811245SRR21814514
1114TGATATGTCTATAATTTGCA-TGACTAAAAACCTATTATCAATHILA6A LTR/Gypsy314158974SRR21814507
1114TGATATGTCTATAATTTGCA-TGACTAAAAACCTATTATCAATHILA6A LTR/Gypsy411141402SRR21814514
1115TGATCTAGTATTAAACTAGA-CCGCTGCCGGGCTTCAAACC513439004SRR21814505
1115TGATCTAGTATTAAACTAGA-CCGCTGCCGGGCTTCAAACC513452844SRR21814505
1116TGATGACTATCCTTGCGGTG-CACCGCAAGGATAGTCATCA318792735SRR13608004
1116TGATGACTATCCTTGCGGTG-CACCGCAAGGATAGTCATCA318792744SRR13608004
1117TGATGCAGGGCATATTTCCT-ATCTATCTTGGTTTACATTA12646483SRR13608004
1117TGATGCAGGGCATATTTCCT-ATCTATCTTGGTTTACATTA41175957SRR21814498
1118TGATGGTGTAGCCGAAGTCT-ACTTCTTATTGCTTCTCAAA42921093SRR13608004
1118TGATGGTGTAGCCGAAGTCT-ACTTCTTATTGCTTCTCAAA42977868SRR21814519
1119TGATTATAATGCTTTCTTAG-TACTTAGGTGAACTTATCAA43560339SRR13608004
1119TGATTATAATGCTTTCTTAG-TACTTAGGTGAACTTATCAA511206179SRR13608004
1120TGATTGTTGATGAAGGACAT-ATGTCCTTCATCAACAATCA56501271SRR13608004
1120TGATTGTTGATGAAGGACAT-ATGTCCTTCATCAACAATCA56501279SRR13608004
1121TGCAAAAATGTATATATAGA-CTCCAGGATTTATTTCACAA121739620SRR21814503
1121TGCAAAAATGTATATATAGA-CTCCAGGATTTATTTCACAA22299088SRR13608004
1121TGCAAAAATGTATATATAGA-CTCCAGGATTTATTTCACAA321552637SRR21814518
1122TGCAACTACATGAACACTCT-TCTAGACTCGATCCTAAATG113942534SRR13608004
1122TGCAACTACATGAACACTCT-TCTAGACTCGATCCTAAATG313553947SRR21814518
1123TGCATTAGATTGTGACACAT-TTCATCTCTAACTCTTATAA114745197SRR21814500
1123TGCATTAGATTGTGACACAT-TTCATCTCTAACTCTTATAA44067212SRR21814500
1124TGCGAGGGATTAGCAACGTT-GAACGTTGCTAATCCCTCGC115867838SRR13608004
1124TGCGAGGGATTAGCAACGTT-GAACGTTGCTAATCCCTCGC115867842SRR13608004
1125TGCGGTATACCGCGGGTTAA-AACTTTAAAATATAAATTGT110852694SRR21814496
1125TGCGGTATACCGCGGGTTAA-AACTTTAAAATATAAATTGT112327955SRR21814496
1126TGCGGTTCTAGTTCTTATAA-CACTACTTTAGCTTTTGGAA42958321SRR21814509
1126TGCGGTTCTAGTTCTTATAA-CACTACTTTAGCTTTTGGAA42979209SRR21814509
1127TGCTCCTCAAAGCTTTGATG-AAAACACTAACCAAGCTTCT114508499SRR13608004
1127TGCTCCTCAAAGCTTTGATG-AAAACACTAACCAAGCTTCT115113247SRR21814517
1128TGCTTAGAAGCAGTAAATAG-AGAGGCTAAAACCAACAAAA115012808SRR21814505
1128TGCTTAGAAGCAGTAAATAG-AGAGGCTAAAACCAACAAAA44058727SRR21814505
1129TGCTTATCAGTTTGGACCAG-TGGTCCAAACTGATAAGCAG23183596SRR13608004
1129TGCTTATCAGTTTGGACCAG-TGGTCCAAACTGATAAGCAG23183606SRR13608004
1130TGCTTCTCAAAGCTTTAATG-AAAACACTAACCAAGCTTCT115437692SRR13608004
1130TGCTTCTCAAAGCTTTAATG-AAAACACTAACCAAGCTTCT115690570SRR13608004
1130TGCTTCTCAAAGCTTTAATG-AAAACACTAACCAAGCTTCT23660840SRR13608004
1131TGCTTCTCAAAGCTTTGATG-AAAACACTAACAAAGCTTCT114511127SRR13608004
1131TGCTTCTCAAAGCTTTGATG-AAAACACTAACAAAGCTTCT115747692SRR21814493SRR21814499SRR21814516
1132TGCTTGCCCTCAAGCAAAAC-ATATCAACTCCCCCAAACTT114341377SRR21814511
1132TGCTTGCCCTCAAGCAAAAC-ATATCAACTCCCCCAAACTT512212330SRR21814511
1133TGCTTGCTTCTCAAAGCTTT-CGACTCCAAAACAGTAACCA114363198SRR21814504
1133TGCTTGCTTCTCAAAGCTTT-CGACTCCAAAACAGTAACCA43950840SRR13608004
1134TGGAACTTGGAAAAATCCTT-ATGAATATATTTTTCCAAAA23610584SRR21814496
1134TGGAACTTGGAAAAATCCTT-ATGAATATATTTTTCCAAAA23611458SRR13608004
1135TGGATTAAGTTACGACAGAT-ATCTGTCGTAACTTAATCCA26692091SRR21814512
1135TGGATTAAGTTACGACAGAT-ATCTGTCGTAACTTAATCCA26692100SRR21814512
1136TGGCAACCATTGTAAATAAG-AAAAAAATCAATAATTAAAA126307033SRR21814516
1136TGGCAACCATTGTAAATAAG-AAAAAAATCAATAATTAAAA28046196SRR21814516
1137TGGGAAAAATGTTATTTAAT-TTAAATAACATTTTTCCCGA126212103SRR21814496
1137TGGGAAAAATGTTATTTAAT-TTAAATAACATTTTTCCCGA414072594SRR21814496
1138TGGGAATTTAATGAAAAAAA-TTTTTTTCATTAAATTCCCT128424487SRR21814488
1138TGGGAATTTAATGAAAAAAA-TTTTTTTCATTAAATTCCCT210580836SRR21814488
1138TGGGAATTTAATGAAAAAAA-TTTTTTTCATTAAATTCCCT48959145SRR21814486
1138TGGGAATTTAATGAAAAAAA-TTTTTTTCATTAAATTCCCT510370824SRR21814488
1138TGGGAATTTAATGAAAAAAA-TTTTTTTCATTAAATTCCCT515941133SRR21814486
1139TGGGGAAGTGTTTATGAAAA-TTTTCATAAACACTTCCCCA312401341SRR13608004
1139TGGGGAAGTGTTTATGAAAA-TTTTCATAAACACTTCCCCA312401348SRR13608004
1140TGGGTATATGCACTAGATGA-GTCATTCAGTAAATTAACCC33120912SRR13608004
1140TGGGTATATGCACTAGATGA-GTCATTCAGTAAATTAACCC317016724SRR21814514
1141TGGTGCATCTCCAGCACCAA-CAATTCCTTTCCTCTGACGG114926032SRR13608004
1141TGGTGCATCTCCAGCACCAA-CAATTCCTTTCCTCTGACGG44763320SRR21814489
1142TGGTGGGACCCACGGCGAAT-TAGATGGGGGATCCCTACAT43054629SRR13608004
1142TGGTGGGACCCACGGCGAAT-TAGATGGGGGATCCCTACAT512807234SRR13608004
1143TGGTGGTACTCGGCCAGGTG-GGTCGAGTGAAGTGATCGAG41811630SRR21814488
1143TGGTGGTACTCGGCCAGGTG-GGTCGAGTGAAGTGATCGAG512639928SRR13608004
1144TGGTGTCGATCGACACCACT-TGAGAGTGGTGTCGATCGAT23729302SRR13608004
1144TGGTGTCGATCGACACCACT-TGAGAGTGGTGTCGATCGAT23847481SRR13608004
1145TGGTTCAACTGGAATGTTAC-TAGTAACATTCCAGTTGAAC26079411SRR13608004
1145TGGTTCAACTGGAATGTTAC-TAGTAACATTCCAGTTGAAC26079417SRR13608004
1146TGTAACAAGTAGTTTTGTTG-CAACAAAACTACTTGTTACA23187893SRR13608004
1146TGTAACAAGTAGTTTTGTTG-CAACAAAACTACTTGTTACA23187901SRR13608004
1147TGTAACGACCGCGTCCCGCG-GTCCGGGACGGGGTCTCACAATGP2N LTR/Gypsy123005074SRR21814518
1147TGTAACGACCGCGTCCCGCG-GTCCGGGACGGGGTCTCACAATGP2N LTR/Gypsy26052SRR21814516
1147TGTAACGACCGCGTCCCGCG-GTCCGGGACGGGGTCTCACAATGP2N LTR/Gypsy29305SRR21814496
1147TGTAACGACCGCGTCCCGCG-GTCCGGGACGGGGTCTCACAATGP2N LTR/Gypsy222362SRR21814496
1147TGTAACGACCGCGTCCCGCG-GTCCGGGACGGGGTCTCACAATGP2N LTR/Gypsy21392350SRR21814516SRR21814518
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy19843928SRR21814496SRR21814502
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy112714438SRR21814490
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy112741500SRR21814509
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy115563317SRR21814518
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy116500107SRR21814516
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy23385SRR21814514
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy25481SRR21814502
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy25509SRR21814490
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy26352SRR21814502
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy26626SRR21814514
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy26999SRR21814514
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy27502SRR21814514
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy27631SRR21814503
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy28163SRR21814496
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy29007SRR21814517
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy29013SRR21814514
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy29073SRR21814501SRR21814514SRR21814516
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy29833SRR21814517
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy219621SRR21814517
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy220480SRR21814518
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy220481SRR21814502
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy221455SRR21814514
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy21752118SRR21814495SRR21814517
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy21906263SRR21814499SRR21814514
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy22717325SRR21814493SRR21814495
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy24070782SRR21814518
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy24954906SRR21814501
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy25398839SRR21814490SRR21814516
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy27174921SRR21814493
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy31961594SRR21814501
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy38264360SRR21814520
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy310861142SRR21814502
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy314191717SRR21814509
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy314193382SRR21814503
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy314193398SRR21814502
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy314842559SRR21814499
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy45480116SRR21814501
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy45960646SRR21814518
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy414642297SRR21814495
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy512186316SRR21814493
1148TGTAACGCCCGCGATCCTCA-GTCCGGATCGGGGCCTTTCAATGP2 LTR/Gypsy514547843SRR21814493SRR21814520
1149TGTAACGCCCGCGATCCTCA-TCCGGATCGGGGCCTTTCAA512186316SRR21814492
1149TGTAACGCCCGCGATCCTCA-TCCGGATCGGGGCCTTTCAA514547843SRR21814492
1150TGTAACGCCCGCGATCCTCA-TCCGGATCGGGGCCTTTCAC22738SRR21814504
1150TGTAACGCCCGCGATCCTCA-TCCGGATCGGGGCCTTTCAC24086SRR21814504
1150TGTAACGCCCGCGATCCTCA-TCCGGATCGGGGCCTTTCAC24097SRR21814504
1150TGTAACGCCCGCGATCCTCA-TCCGGATCGGGGCCTTTCAC24134SRR21814504
1150TGTAACGCCCGCGATCCTCA-TCCGGATCGGGGCCTTTCAC24491SRR21814504
1150TGTAACGCCCGCGATCCTCA-TCCGGATCGGGGCCTTTCAC25100SRR21814504
1150TGTAACGCCCGCGATCCTCA-TCCGGATCGGGGCCTTTCAC26428SRR21814504
1150TGTAACGCCCGCGATCCTCA-TCCGGATCGGGGCCTTTCAC26960SRR21814504
1150TGTAACGCCCGCGATCCTCA-TCCGGATCGGGGCCTTTCAC27186SRR21814504
1150TGTAACGCCCGCGATCCTCA-TCCGGATCGGGGCCTTTCAC27265SRR21814504
1150TGTAACGCCCGCGATCCTCA-TCCGGATCGGGGCCTTTCAC27476SRR21814512
1150TGTAACGCCCGCGATCCTCA-TCCGGATCGGGGCCTTTCAC27796SRR21814506
1150TGTAACGCCCGCGATCCTCA-TCCGGATCGGGGCCTTTCAC28261SRR21814504
1150TGTAACGCCCGCGATCCTCA-TCCGGATCGGGGCCTTTCAC21906263SRR21814504
1150TGTAACGCCCGCGATCCTCA-TCCGGATCGGGGCCTTTCAC25398839SRR21814512
1150TGTAACGCCCGCGATCCTCA-TCCGGATCGGGGCCTTTCAC314124736SRR21814506
1150TGTAACGCCCGCGATCCTCA-TCCGGATCGGGGCCTTTCAC314193302SRR21814504
1151TGTACCATATGACCCGAATG-TATACCATATTTATTTAATA318019203SRR13608004
1151TGTACCATATGACCCGAATG-TATACCATATTTATTTAATA524186545SRR21814505
1152TGTAGAATAAGGTATTGAAC-ATAACATATATCCCCAATAC2337179SRR21814497
1152TGTAGAATAAGGTATTGAAC-ATAACATATATCCCCAATAC210158156SRR21814497
1153TGTAGAATAAGGTATTGAAC-GTTCAATACCTTATTCTACA212374121SRR21814487SRR21814491SRR21814495SRR21814507
1153TGTAGAATAAGGTATTGAAC-GTTCAATACCTTATTCTACA212374125SRR21814487SRR21814491SRR21814495SRR21814507
1153TGTAGAATAAGGTATTGAAC-GTTCAATACCTTATTCTACA46507626SRR21814499
1153TGTAGAATAAGGTATTGAAC-GTTCAATACCTTATTCTACA46507630SRR21814499
1154TGTAGAATTAGGTATTGAAC-GTTCAATACCTAATTCTACA312124586SRR21814496
1154TGTAGAATTAGGTATTGAAC-GTTCAATACCTAATTCTACA312124590SRR21814496
1155TGTAGAATTAGGTATTGAAC-TATACGACCTTATCACAATA18718228SRR21814492SRR21814493SRR21814506SRR21814519
1155TGTAGAATTAGGTATTGAAC-TATACGACCTTATCACAATA124470195SRR21814506
1155TGTAGAATTAGGTATTGAAC-TATACGACCTTATCACAATA32654601SRR21814492SRR21814493
1155TGTAGAATTAGGTATTGAAC-TATACGACCTTATCACAATA513859854SRR21814519
1156TGTAGAGAATAGTTGGTTAA-ATGATGCAATTCTTTCAACA124450474SRR21814499
1156TGTAGAGAATAGTTGGTTAA-ATGATGCAATTCTTTCAACA3980748SRR21814490
1156TGTAGAGAATAGTTGGTTAA-ATGATGCAATTCTTTCAACA321573687SRR21814518
1156TGTAGAGAATAGTTGGTTAA-ATGATGCAATTCTTTCAACA321590689SRR21814490
1156TGTAGAGAATAGTTGGTTAA-ATGATGCAATTCTTTCAACA4648397SRR21814486SRR21814487SRR21814495SRR21814501
1156TGTAGAGAATAGTTGGTTAA-ATGATGCAATTCTTTCAACA46430154SRR21814486SRR21814495SRR21814500SRR21814518
1156TGTAGAGAATAGTTGGTTAA-ATGATGCAATTCTTTCAACA520364557SRR21814487SRR21814490SRR21814499
1156TGTAGAGAATAGTTGGTTAA-ATGATGCAATTCTTTCAACA524694443SRR21814487SRR21814500SRR21814501
1157TGTAGAGAATAGTTGGTTAA-GATGATGCAATTCTTTCAAC124450474SRR21814506
1157TGTAGAGAATAGTTGGTTAA-GATGATGCAATTCTTTCAAC520364557SRR21814506
1158TGTAGAGTATATAAGTAAAG-ATTCAGCCTTCAATACTATA119057021SRR21814513
1158TGTAGAGTATATAAGTAAAG-ATTCAGCCTTCAATACTATA2616536SRR21814498
1158TGTAGAGTATATAAGTAAAG-ATTCAGCCTTCAATACTATA310880352SRR21814513
1158TGTAGAGTATATAAGTAAAG-ATTCAGCCTTCAATACTATA42693544SRR21814498
1159TGTAGCCAAAGTCAATATGA-TTCTTCTAGCTTCTCAAAGC23617306SRR13608004
1159TGTAGCCAAAGTCAATATGA-TTCTTCTAGCTTCTCAAAGC511974479SRR13608004
1160TGTAGCCATGGTCTTCCCAA-GGAAGACCATGGCTACACGC114204589SRR13608004
1160TGTAGCCATGGTCTTCCCAA-GGAAGACCATGGCTACACGC43109103SRR13608004
1161TGTATAGAAAAAGTTCTTGA-TCAAGAACTTTTTCTATACA210637927SRR13608004
1161TGTATAGAAAAAGTTCTTGA-TCAAGAACTTTTTCTATACA210637935SRR13608004
1162TGTATCCTTGTTAGAATACA-AACCGGATCTTAAAAGCCTA511661201SRR13608004
1162TGTATCCTTGTTAGAATACA-AACCGGATCTTAAAAGCCTA511958610SRR13608004
1163TGTATCTTCTAACAAAGAAA-AAAGTCCATATGAGTCTTTG43979054SRR21814500
1163TGTATCTTCTAACAAAGAAA-AAAGTCCATATGAGTCTTTG511683054SRR13608004
1163TGTATCTTCTAACAAAGAAA-AAAGTCCATATGAGTCTTTG511756480SRR21814511
1164TGTATGATTGAGTATAAGAA-TTTTGGAGTCGAATATGACT43012930SRR21814505
1164TGTATGATTGAGTATAAGAA-TTTTGGAGTCGAATATGACT512043559SRR21814505
1165TGTCACAATCCAATGCATTT-TCTGTGTTTCTATGGTCAAA114602912SRR21814506SRR21814512SRR21814516
1165TGTCACAATCCAATGCATTT-TCTGTGTTTCTATGGTCAAA114977559SRR21814494SRR21814506SRR21814512SRR21814516
1165TGTCACAATCCAATGCATTT-TCTGTGTTTCTATGGTCAAA44057326SRR21814494
1166TGTCACACATGGACAATCCA-GGATTGTCCATGTGTGACAC110461987SRR13608004
1166TGTCACACATGGACAATCCA-GGATTGTCCATGTGTGACAC110461993SRR13608004
1167TGTCATGTGTATGAGTAAGT-TTTAGTGTTTTGGAGTCAAA42941387SRR21814497
1167TGTCATGTGTATGAGTAAGT-TTTAGTGTTTTGGAGTCAAA511828362SRR21814497
1168TGTCGATCGACACCATCGCG-CAGAAGGGTGTCGATCGACA23850464SRR13608004
1168TGTCGATCGACACCATCGCG-CAGAAGGGTGTCGATCGACA511995408SRR21814500SRR21814501
1169TGTCGATCGACACCATCGCG-CGCGATGGTGTCGATCGACA511166390SRR13608004
1169TGTCGATCGACACCATCGCG-CGCGATGGTGTCGATCGACA513123362SRR13608004
1170TGTCGATCGACACCATCGGG-AGATGGTGTCGATCGACACC113299918SRR13608004
1170TGTCGATCGACACCATCGGG-AGATGGTGTCGATCGACACC113594705SRR13608004
1171TGTCGATCGACACCCTCCTG-CAGGAGGGTGTCGATCGACA312751025SRR13608004
1171TGTCGATCGACACCCTCCTG-CAGGAGGGTGTCGATCGACA312751034SRR13608004
1172TGTCGTTTGGAGCTGTTCTG-CAGAACAGCTCCAAACGACA26422578SRR13608004
1172TGTCGTTTGGAGCTGTTCTG-CAGAACAGCTCCAAACGACA26422586SRR13608004
1173TGTCTGTCTCTTATACACAT-GTATAAGAGACAGATTTATT18091600SRR13608004
1173TGTCTGTCTCTTATACACAT-GTATAAGAGACAGATTTATT24844096SRR13608004
1173TGTCTGTCTCTTATACACAT-GTATAAGAGACAGATTTATT24844101SRR13608004
1173TGTCTGTCTCTTATACACAT-GTATAAGAGACAGATTTATT218648242SRR13608004
1173TGTCTGTCTCTTATACACAT-GTATAAGAGACAGATTTATT521514625SRR13608004
1174TGTCTGTCTCTTATACACAT-TGTATAAGAGACAGACATTA128244716SRR13608004
1174TGTCTGTCTCTTATACACAT-TGTATAAGAGACAGACATTA210603847SRR13608004
1174TGTCTGTCTCTTATACACAT-TGTATAAGAGACAGACATTA57704278SRR13608004
1175TGTGAAGAACTAACTTGTTT-CCAACAAGTGGTTTACAACA25170950SRR21814507
1175TGTGAAGAACTAACTTGTTT-CCAACAAGTGGTTTACAACA411298300SRR21814507
1176TGTGAATTGTTTGACTAAAA-GACTTTTTCAAACACCAACA118427749SRR21814488
1176TGTGAATTGTTTGACTAAAA-GACTTTTTCAAACACCAACA36009707SRR21814495SRR21814514
1176TGTGAATTGTTTGACTAAAA-GACTTTTTCAAACACCAACA311415635SRR21814495
1176TGTGAATTGTTTGACTAAAA-GACTTTTTCAAACACCAACA314273777SRR21814495
1176TGTGAATTGTTTGACTAAAA-GACTTTTTCAAACACCAACA519863932SRR21814514
1176TGTGAATTGTTTGACTAAAA-GACTTTTTCAAACACCAACA526627790SRR21814488
1177TGTGAGACCCCGTCCCGGAC-CGCGGGACGCGGTCGTTACA27476SRR21814490
1177TGTGAGACCCCGTCCCGGAC-CGCGGGACGCGGTCGTTACA21392354SRR21814490
1177TGTGAGACCCCGTCCCGGAC-CGCGGGACGCGGTCGTTACA59063912SRR21814490
1178TGTGAGACCCCGTCCCGGAC-CGGGACGCGGTCGTTACAGA21392354SRR21814516
1178TGTGAGACCCCGTCCCGGAC-CGGGACGCGGTCGTTACAGA25486285SRR21814516
1179TGTGAGACCCCGTCCCGGAC-GCGGGACGCGGTCGTTACAA25470SRR21814507
1179TGTGAGACCCCGTCCCGGAC-GCGGGACGCGGTCGTTACAA510805547SRR21814507
1180TGTGAGACCCCGTCCCGGAC-GCGGGACGCGGTCGTTACAG123005070SRR21814518
1180TGTGAGACCCCGTCCCGGAC-GCGGGACGCGGTCGTTACAG29309SRR21814496
1180TGTGAGACCCCGTCCCGGAC-GCGGGACGCGGTCGTTACAG222358SRR21814496
1180TGTGAGACCCCGTCCCGGAC-GCGGGACGCGGTCGTTACAG21392354SRR21814518
1181TGTGAGAGTCGAAACTCGCA-GGTCAAATCCGACCCCAACA311921088SRR21814496
1181TGTGAGAGTCGAAACTCGCA-GGTCAAATCCGACCCCAACA513061182SRR21814496
1182TGTGATAACTTTTCGGAAAG-TCTATACCGTGAGGCCAAAC314181117SRR21814500
1182TGTGATAACTTTTCGGAAAG-TCTATACCGTGAGGCCAAAC512813447SRR13608004
1183TGTGATGCAAACAGATGAAA-TATTTTAGGTGTCAATCCAA24593724SRR21814499
1183TGTGATGCAAACAGATGAAA-TATTTTAGGTGTCAATCCAA43496393SRR13608004
1184TGTGATTTTCCCGCCAAAAA-AATTTTCCCGCCAAAAAACG113087804SRR13608004
1184TGTGATTTTCCCGCCAAAAA-AATTTTCCCGCCAAAAAACG117710274SRR21814502
1185TGTGGAGAGTATTTTACCAC-TGGTAAAATACTCTCCACAT41532286SRR13608004
1185TGTGGAGAGTATTTTACCAC-TGGTAAAATACTCTCCACAT41532294SRR13608004
1186TGTGGATGTCGGAATCCGCA-CCGAATCCGACATCCACAAT27975617SRR21814508SRR21814512
1186TGTGGATGTCGGAATCCGCA-CCGAATCCGACATCCACAAT38868396SRR21814511
1186TGTGGATGTCGGAATCCGCA-CCGAATCCGACATCCACAAT48027699SRR13608004
1187TGTGGATGTCGGAATCCGCA-CCGAATCCGACATCCACAGT34875520SRR21814506
1187TGTGGATGTCGGAATCCGCA-CCGAATCCGACATCCACAGT323130757SRR21814506
1187TGTGGATGTCGGAATCCGCA-CCGAATCCGACATCCACAGT46008628SRR21814506
1188TGTGGATGTCGGAATCCGCA-GGCCGAATCCGACATCCACA317681956SRR21814515
1188TGTGGATGTCGGAATCCGCA-GGCCGAATCCGACATCCACA48027699SRR13608004
1188TGTGGATGTCGGAATCCGCA-GGCCGAATCCGACATCCACA514556285SRR21814496SRR21814507SRR21814517
1189TGTGGATGTCGGATTCGGCC-TGCGGATTCCGACATCCACATAT1_ATH LTR/Gypsy317681952SRR21814515
1189TGTGGATGTCGGATTCGGCC-TGCGGATTCCGACATCCACATAT1_ATH LTR/Gypsy48027703SRR13608004
1190TGTGTTGAAAGTTAAACTTG-AAAGAATTTTACTCTAACAA319451894SRR21814491
1190TGTGTTGAAAGTTAAACTTG-AAAGAATTTTACTCTAACAA411815006SRR21814491
1191TGTTAAAAGATCCAAAACCA-ATGAACCTAAATTTATATTT115115409SRR13608004
1191TGTTAAAAGATCCAAAACCA-ATGAACCTAAATTTATATTT115259805SRR13608004
1192TGTTAAGAAACAAACTCCAA-AAACCCTATTGAGCTTATCA113254745SRR21814505
1192TGTTAAGAAACAAACTCCAA-AAACCCTATTGAGCTTATCA3630478SRR21814504
1192TGTTAAGAAACAAACTCCAA-AAACCCTATTGAGCTTATCA318422196SRR21814504SRR21814505
1192TGTTAAGAAACAAACTCCAA-AAACCCTATTGAGCTTATCA515365707SRR21814504
1193TGTTAAGCACGAAGCCTAAC-AGGGTATCTTCAACCTATCA310892804SRR21814498
1193TGTTAAGCACGAAGCCTAAC-AGGGTATCTTCAACCTATCA59480259SRR21814498
1194TGTTAATGCACGAATTAAAC-CCCAAATCTAACCCCTAACA16210543SRR21814492
1194TGTTAATGCACGAATTAAAC-CCCAAATCTAACCCCTAACA111457817SRR21814492SRR21814515
1194TGTTAATGCACGAATTAAAC-CCCAAATCTAACCCCTAACA111464966SRR21814515
1194TGTTAATGCACGAATTAAAC-CCCAAATCTAACCCCTAACA21000758SRR21814492SRR21814509
1194TGTTAATGCACGAATTAAAC-CCCAAATCTAACCCCTAACA323128744SRR21814509
1195TGTTAATGCACGAATTAAAC-GCCCAATTGATGTATCAACA111128099SRR21814497
1195TGTTAATGCACGAATTAAAC-GCCCAATTGATGTATCAACA111458015SRR21814520
1195TGTTAATGCACGAATTAAAC-GCCCAATTGATGTATCAACA210976175SRR21814520
1195TGTTAATGCACGAATTAAAC-GCCCAATTGATGTATCAACA516328850SRR21814497
1196TGTTAATGCACGAATTAAAC-GTTTAATTCGTGCATTAACA316924509SRR21814496
1196TGTTAATGCACGAATTAAAC-GTTTAATTCGTGCATTAACA316924513SRR21814496
1196TGTTAATGCACGAATTAAAC-GTTTAATTCGTGCATTAACA415508108SRR21814496SRR21814501SRR21814505SRR21814506SRR21814516
1196TGTTAATGCACGAATTAAAC-GTTTAATTCGTGCATTAACA415508112SRR21814496SRR21814501SRR21814505SRR21814506SRR21814516
1197TGTTAATGTTTTGTTATGAA-GATTTGATTATTCTTCAACA121908080SRR21814496SRR21814499
1197TGTTAATGTTTTGTTATGAA-GATTTGATTATTCTTCAACA411000864SRR21814489SRR21814496SRR21814499
1197TGTTAATGTTTTGTTATGAA-GATTTGATTATTCTTCAACA522691441SRR21814489
1198TGTTACAGGGAAACCTGCGA-CACACGTTAATCCTGTATCA24223764SRR21814512SRR21814514
1198TGTTACAGGGAAACCTGCGA-CACACGTTAATCCTGTATCA316718779SRR21814514
1198TGTTACAGGGAAACCTGCGA-CACACGTTAATCCTGTATCA45773832SRR21814512SRR21814514
1199TGTTAGAAAAGAAGAAGAAG-TCCATCTAATATTCATAACA16474595SRR21814519
1199TGTTAGAAAAGAAGAAGAAG-TCCATCTAATATTCATAACA111736482SRR21814518
1199TGTTAGAAAAGAAGAAGAAG-TCCATCTAATATTCATAACA215131028SRR21814492SRR21814516SRR21814518
1199TGTTAGAAAAGAAGAAGAAG-TCCATCTAATATTCATAACA36183233SRR21814492SRR21814493
1199TGTTAGAAAAGAAGAAGAAG-TCCATCTAATATTCATAACA311208023SRR21814492SRR21814493
1199TGTTAGAAAAGAAGAAGAAG-TCCATCTAATATTCATAACA47012849SRR21814516
1199TGTTAGAAAAGAAGAAGAAG-TCCATCTAATATTCATAACA411201370SRR21814516
1199TGTTAGAAAAGAAGAAGAAG-TCCATCTAATATTCATAACA