Polymorphic Edge Detection (PED) - An efficient polymorphism detector for NGS data

Example for Arabidopsis thaliana

Target region from 5 to 10 Mb in chromosome 1 is detected with homozygous mutaions.

Click to large.
The mutmap is a method to identify the genomic region associated with the desired phenotype.
The region in chromosome 1 may contain awf1 mutation.
Samples are made for mutmap screen of Arabidopsis thaliana.

For Install linux machine (Ubuntu),
$ sudo apt update
$ sudo apt upgrade
$ sudo apt install curl
$ sudo apt install git
$ git clone https://github.com/akiomiyao/ped.git
To download sequence data, fastq-dump from NCBI is required.
Tool kit can be download from https://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=software
Details of setup fastq-dump is described in https://akiomiyao.github.io/ped/sratoolkit/index.html
Download fastq sequence data from NCBI sequence read archive
$ cd ped
$ perl download.pl accession=DRR195469
$ perl download.pl accession=DRR195470
Detection of polymorphism
$ perl ped.pl target=DRR195470,control=DRR195469,ref=TAIR10
For Docker users
Set up of Docker,
$ sudo apt install docker
$ sudo apt install docker.io
Example of analysis,
$ sudo docker pull akiomiyao/ped
$ sudo docker run -w /ped -v `pwd`:/work akiomiyao/ped perl download.pl accession=DRR195469,wd=/work
$ sudo docker run -w /ped -v `pwd`:/work akiomiyao/ped perl download.pl accession=DRR195470,wd=/work
$ sudo docker run -w /ped -v `pwd`:/work akiomiyao/ped perl ped.pl target=DRR195470,control=DRR195469,ref=TAIR10,wd=/work
Copy and paste commands described above to your terminal window, change values of accession, target and clipping, and run.
Both the ped.pl script and the docker container can be run on Google Cloud Platform and Amazon Web Services.
Viewing mutations with Integrative Genomics Viewer
Integrative Genomics Viewer (IVG) is a product of Broad Institute.
Download and install IVG from http://software.broadinstitute.org/software/igv/download.
Fasta file of reference is saved in "ped/TAIR10/TAIR10.fasta".
Click Genomes tab of IVG and load "TAIR10.fasta" and "TAIR10.gff" files.
Click File tab and load "ped/DRR195470/DRR195470.vcf" and other vcf files or drop files on the main window.

Check mutation in bidirectional alignments
In the ped directory,
$ perl search.pl target=target,chr=chromosome,pos=position

For example,
$ perl search.pl target=DRR195470,chr=1,pos=13466340

A part of output is

# 1 13466340 1 13466302 f deletion -4
AAACCTACAAATAATCATAT TGAATTGTTGGTTTAGAGAT 0
                                                                                                                              Chr1 13466340
                                                                                                                              |
AAACCTACAAATAATCATATTTTGTTTTCAGTTTTGACATATATAGTATGAGCATAAGTACCATATATAATTAGCACAAATTTGAATATATATATATATATATATATATATATATATATATATATATATACTAATTGAATTGTTGGTTTAG
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   | | | |   | |||     |
AAACCTACAAATAATCATATTTTGTTTTCAGTTTTGACATATATAGTATGAGCATAAGTACCATATATAATTAGCACAAATTTGAATATATATATATATATATATATATATATATATATATATATACTAATTGAATTGTTGGTTTAGAGAT
  ||  | ||  |    |  |||    |        | |||    |        ||      |||  ||      |      |  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CTACAAATAATCATATTTTGTTTTCAGTTTTGACATATATAGTATGAGCATAAGTACCATATATAATTAGCACAAATTTGAATATATATATATATATATATATATATATATATATATATATATATACTAATTGAATTGTTGGTTTAGAGAT
                                                                                    |
                                                                                    Chr1 13466302

Files
Click to download
TAIR10.fasta
TAIR10_GFF3_genes.gff Modified for PED.
DRR195470.vcf
Comments
Run time is about one day for each accession using Intel Core i5-4210M CPU @ 2.60 GHz (2 cores, 4 threads), 8GB memory.
Reads from Illumina platform returns fine results.
Citation
Cite this article as: Polymorphic edge detection (PED): two efficient methods of polymorphism detection from next-generation sequencing data
Akio Miyao, Jianyu Song Kiyomiya, Keiko Iida, Koji Doi, Hiroshi Yasue
BMC Bioinformatics. 2019 20(1):362.
URL https://doi.org/10.1186/s12859-019-2955-6

Kato H, Onai K, Abe A, Shimizu M, Takagi H, Tateda C, Utsushi H, Singkarabanit-Ogawa S, Kitakura S, Ono E, Zipfel C, Takano Y, Ishiura M, Terauchi R. Lumi-Map, a Real-Time Luciferase Bioluminescence Screen of Mutants Combined with MutMap, Reveals Arabidopsis Genes Involved in PAMP-Triggered Immunity. Mol Plant Microbe Interact. 2020 33(12):1366-1380. doi: 10.1094/MPMI-05-20-0118-TA
Author
Akio Miyao (miyao@affrc.go.jp)